Gene/Protein Characteristic Table for FLJ00208

Description

Product ID:	ORK05117
Accession No.:	AK074135
Alias Name:
Clone Name:	sj04945 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4362
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3360 bp

Genome contig ID gi29824578r_44609045
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CGCCCCGCCAGCGCTGCAAATAAACCTTTTGAGTC
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 333

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB84961	1.7e-143	100.0	FLJ00208 protei...	Homo sapiens
EAW61070	7.6e-143	99.7	myosin IG, isof...	Homo sapiens
EAW61071	9.7e-143	99.7	myosin IG, isof...	Homo sapiens
B0I1T2	1.1e-142	99.7	Myosin-Ig; Cont...	Homo sapiens
AAK58092	6.8e-142	99.4	unconventional ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AK131089	5.8e-137	99.7	FLJ00293
AK074050	1.4e-125	98.7	FLJ00121
AB018270	2.6e-69	55.3	KIAA0727
AB002387	6.7e-31	34.9	KIAA0389
AB020673	3.9e-28	36.9	KIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 2 75 PD000355 Myosin head (motor domain)

HMMPfam IPR001609 1 333 PF00063 Myosin head (motor domain)

HMMSmart IPR001609 1 333 SM00242 Myosin head (motor domain)

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	2	75	PD000355	Myosin head (motor domain)
HMMPfam	IPR001609	1	333	PF00063	Myosin head (motor domain)
HMMSmart	IPR001609	1	333	SM00242	Myosin head (motor domain)

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3360 bp
Genome contig ID	gi29824578r_44609045
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CGCCCCGCCAGCGCTGCAAATAAACCTTTTGAGTC
Flanking genome sequence	None