Gene/Protein Characteristic Table for FLJ00293

Description

Product ID:	ORK06084
Accession No.:	AK131089
Alias Name:
Clone Name:	sh03709 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 5391
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 73 bp

Genome contig ID gi29824578r_44609045
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CGCCCCGCCAGCGCTGCAAATAAACCTTCTGAGTC
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 812

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC85139	100.0	FLJ00293 protei...	Homo sapiens
EAW61071	100.0	myosin IG, isof...	Homo sapiens
B0I1T2	100.0	Myosin-Ig; Cont...	Homo sapiens
XP_001148961	98.5	myosin IG isofo...	Pan troglodytes
XP_519077	98.5	myosin IG isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018270	2.5e-180	55.7	KIAA0727
AK074135	6.3e-124	99.7	FLJ00208
AK074050	8.4e-114	99.0	FLJ00121
AK131106	7e-45	38.7	FLJ00395
AB002387	1.2e-40	31.9	KIAA0389

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001609 1 488 PF00063 Myosin head (motor domain)

IPR010926 608 811 PF06017 Myosin tail 2

HMMSmart IPR001609 1 502 SM00242 Myosin head (motor domain)

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001609	1	488	PF00063	Myosin head (motor domain)
IPR010926	608	811	PF06017	Myosin tail 2
HMMSmart	IPR001609	1	502	SM00242	Myosin head (motor domain)

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	73 bp
Genome contig ID	gi29824578r_44609045
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CGCCCCGCCAGCGCTGCAAATAAACCTTCTGAGTC
Flanking genome sequence	None