HUGE

Gene/Protein Characteristic Table for KIAA0866

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01129
Accession No. :	AB020673
Description :	Myosin-11.
HUGO Gene Name :
Clone Name :	hk00546s1 [Vector Info]
Flexi ORF Clone :	pF1KA0866
Source :	Human adult brain
Note :	We replaced hk06733, former representative clones for KIAA0866 with hk00546s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 852 bp

Genome contig ID gi51511732r_15604497
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTAAAAACACTTTCACTAATAAATGGTTATAAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAATGTCGTTGGCTTTTCTGTTGAGCTGTTTTCTATAGAGGAAAAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 15704497 15858356 41 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1984 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P35749	100.0	Myosin-11; Myos...	Homo sapiens
AAS98910	99.6	smooth muscle m...	Homo sapiens
EAW53927	99.8	myosin, heavy p...	Homo sapiens
XP_850764	97.9	similar to smoo...	Canis lupus fam...
XP_862820	97.7	similar to smoo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111886	1.6e-108	59.8	KIAA2034
AB040945	3.3e-99	40.4	KIAA1512
AB023217	2.8e-74	37.1	KIAA1000
AB032945	2.4e-41	28.0	KIAA1119
AB018270	2.4e-25	35.8	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001609 227 262 PD000355 Myosin head

FPrintScan IPR001609 127 146 PR00193 Myosin head

IPR001609 183 208 PR00193 Myosin head

IPR001609 235 262 PR00193 Myosin head

IPR001609 466 494 PR00193 Myosin head

IPR001609 520 548 PR00193 Myosin head

HMMPfam IPR004009 45 87 PF02736 Myosin

IPR001609 99 783 PF00063 Myosin head

IPR000048 799 819 PF00612 IQ calmodulin-binding region

IPR002928 1085 1942 PF01576 Myosin tail

HMMSmart IPR001609 91 796 SM00242 Myosin head

IPR000048 797 819 SM00015 IQ calmodulin-binding region

ProfileScan IPR000048 798 827 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	227	262	PD000355	Myosin head
FPrintScan	IPR001609	127	146	PR00193	Myosin head
IPR001609	183	208	PR00193	Myosin head
IPR001609	235	262	PR00193	Myosin head
IPR001609	466	494	PR00193	Myosin head
IPR001609	520	548	PR00193	Myosin head
HMMPfam	IPR004009	45	87	PF02736	Myosin
IPR001609	99	783	PF00063	Myosin head
IPR000048	799	819	PF00612	IQ calmodulin-binding region
IPR002928	1085	1942	PF01576	Myosin tail
HMMSmart	IPR001609	91	796	SM00242	Myosin head
IPR000048	797	819	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	798	827	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCTCAGACACGCACAGTTC

Primer_r
: GTCAGGGTGTAAACAGTGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACCTCAGACACGCACAGTTC
Primer_r	: GTCAGGGTGTAAACAGTGCAG
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	852 bp
Genome contig ID	gi51511732r_15604497
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTAAAAACACTTTCACTAATAAATGGTTATAAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATGTCGTTGGCTTTTCTGTTGAGCTGTTTTCTATAGAGGAAAAGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	15704497	15858356	41	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0866

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information