| HUGE |
Gene/Protein Characteristic Table for KIAA0389 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01080 |
|---|---|
| Accession No. : | AB002387 |
| Description : | Myosin-VI. |
| HUGO Gene Name : | myosin VI (MYO6) |
| Clone Name : | hj00061 [Vector Info] |
| Flexi ORF Clone : | pF1KA0389
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5212 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1296 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GCTGTAATTCCCAAAACTCTC | |
| : TCAGACCAAAACATTAGTGCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : GeneBridge 4 | |
| : GCTGTAATTCCCAAAACTCTC | |
| : TCAGACCAAAACATTAGTGCC | |
| : 253 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |