KIAA1811

Product ID	ORK04289
Accession No	AB058714
Description	BR serine/threonine kinase 1
Clone name	ha06731
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2576 bp) Predicted protein sequence (715 aa)
Source	Human adult brain

Length: 2576 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	427 bp
Genome contig ID	gi42406306f_60390239
PolyA signal sequence (None)	+--------+--------+----*----+---- GATTTGCTCTCCGGAAGGAATTCTGGTTTCGCGTG
Flanking genome sequence (125438 - 125487)	----+--------+--------+--------+--------+----* ATCCTGCCTGCGTCCGTGTCTCTGATTCCGCCGGCGGCAAAAAAAAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	60490239	60515675	18	100.0	Perfect prediction

Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD38950	9e-197	100.0	hypothetical pr...	Homo sapiens
AAL87698	9.2e-197	100.0	protein kinase-...	Homo sapiens
Q8TDC3	9.4e-197	100.0	BR serine/threo...	Homo sapiens
XP_001489769	2.2e-195	99.3	BR serine/threo...	Equus caballus
AAT08446	3e-195	99.3	putative serine...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	1.4e-16	36.5	KIAA0999
AB058763	5e-16	35.5	KIAA1860
AB018324	8.9e-16	31.0	KIAA0781
D79997	5.3e-12	37.5	KIAA0175
AB040910	5.4e-12	32.3	KIAA1477

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1	221	PD000001	Protein kinase
HMMPfam	IPR000719	1	222	PF00069	Protein kinase
HMMSmart	IPR001245	1	223	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	1	222	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	222	PS50011	Protein kinase
ProfileScan	IPR000449	251	293	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR008271	89	101	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	152	WSCGVILFALLVGALPFDDDNLR	174	PRIMARY	23

Primer_f	TCTCAACTCCATCCGCAACAG
Primer_r	GATGCTGCTGAGAGGTTTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-