KIAA0175

Product ID	ORK05968
Accession No	D79997
Description	maternal embryonic leucine zipper kinase, transcript variant 1
Clone name	ha02337
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2470 bp) Predicted protein sequence (656 aa)
HaloTag ORF Clone	FHC05968
Flexi ORF Clone	FXC05968
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0175 by Kazusa Mouse cDNA Project

Length: 2470 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	344 bp
Genome contig ID	gi89161216f_36462873
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAATTTCTTTCTGAAATAAAACCATTTGTGAATAT
Flanking genome sequence (204807 - 204856)	----+--------+--------+--------+--------+----* AGCAGGCTTCTCTTTTTTGTATTTGATTTTGATCCAAATAAAACCTCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	36562873	36667678	18	100.0	Perfect prediction

Length: 656 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14680	100.0	Maternal embryo...	Homo sapiens
BAD96531	99.8	maternal embryo...	Homo sapiens
XP_001168921	99.5	maternal embryo...	Pan troglodytes
XP_001115076	96.5	maternal embryo...	Macaca mulatta
BAF73615	99.8	maternal embryo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058763	1.2e-45	42.9	KIAA1860
AB023216	4.2e-42	39.9	KIAA0999
AB018324	1.8e-41	37.9	KIAA0781
D43636	7.8e-40	36.5	KIAA0096
AB011109	2.1e-38	31.0	KIAA0537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	16	267	PD000001	Protein kinase
HMMPfam	IPR000719	16	268	PF00069	Protein kinase
HMMPfam	IPR001772	607	656	PF02149	Kinase-associated KA1
HMMSmart	IPR001245	16	268	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	16	268	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	16	268	PS50011	Protein kinase
ProfileScan	IPR001772	607	656	PS50032	Kinase-associated KA1
ScanRegExp	IPR000719	22	45	PS00107	Protein kinase
ScanRegExp	IPR008271	133	145	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	25	GGFAKVKLACHILTGEMVAIKIM	47	SECONDARY	23
SOSUI2	2	195	ADVWSMGILLYVLMCGFLPF	214	PRIMARY	20

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGATGAGTGTGGGTGTGATAC
Primer_r	TGACAGATGGGCTTGATTTAG
PCR product length	173 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles