ROUGE

Gene/Protein Characteristic Table for mKIAA4250

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129077
Description :
Clone Name :	mpj00429 [Vector Info]
Source :	Mouse embryonic tail
Note :	The gene name of mpj00429 was changed from mKIAA0176 to mKIAA4250, because this gene is not a mouse ortholog of KIAA0176

Features of the cloned DNA sequence	Description

Length: 2396 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1674 bp

Genome contig ID gi65550231r_21751737
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TTTCCCCTGGAAATAGTAAATAAAATTGTGTATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGACTGTGTTCAGCAACTGTGAATATCTTGAAGTGTGTGGAGAAGTGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..719
Length: 239 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8VC57	3.3e-99	100.0	BTB/POZ domain-...	Mus musculus
BAE25476	6.1e-99	99.6	unnamed protein...	Mus musculus
EDM03804	1.9e-97	97.9	potassium chann...	Rattus norvegicus
XP_547178	5.2e-96	96.2	similar to Pota...	Canis lupus fam...
AAI42482	6.3e-95	94.9	KCTD5 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220381	2.8e-08	34.9	mKIAA1317
AB093280	8e-05	29.1	mKIAA1044

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003131 51 143 PF02214 K+ channel tetramerisation

HMMSmart IPR000210 49 151 SM00225 BTB/POZ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	51	143	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	49	151	SM00225	BTB/POZ

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1674 bp
Genome contig ID	gi65550231r_21751737
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTTCCCCTGGAAATAGTAAATAAAATTGTGTATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGACTGTGTTCAGCAACTGTGAATATCTTGAAGTGTGTGGAGAAGTGTT

Gene/Protein Characteristic Table for mKIAA4250

Features of the cloned DNA sequence

Features of the protein sequence