ROUGE

Gene/Protein Characteristic Table for mKIAA1317

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220381
Description :
Clone Name :	mbp02166 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 38 bp

Genome contig ID gi65551972f_40382186
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
GAGGGCTGTGGGTAGTCGCCACTTTGAAATAAACC
Flanking genome sequence
(372704 - 372753)
----+----*----+----*----+----*----+----*----+----*
TCCCCAAAGGAAGACATATGTTAAAGGAAAAATAACAACTAACGGTCCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1317 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1317	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1258
Length: 418 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5DTY9	7.4e-173	100.0	BTB/POZ domain-...	Mus musculus
XP_225971	6.6e-172	99.3	similar to pota...	Rattus norvegicus
XP_001917937	2e-168	96.4	potassium chann...	Equus caballus
XP_001098121	5.4e-168	96.2	similar to pota...	Macaca mulatta
Q68DU8	5.4e-168	96.2	BTB/POZ domain-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173260	3.9e-29	53.3	mKIAA1778
AK129077	4.6e-07	34.9	mKIAA4250

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003131 18 113 PF02214 K+ channel tetramerisation

HMMSmart IPR000210 16 121 SM00225 BTB/POZ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	18	113	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	16	121	SM00225	BTB/POZ

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	38 bp
Genome contig ID	gi65551972f_40382186
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GAGGGCTGTGGGTAGTCGCCACTTTGAAATAAACC
Flanking genome sequence (372704 - 372753)	----+--------+--------+--------+--------+----* TCCCCAAAGGAAGACATATGTTAAAGGAAAAATAACAACTAACGGTCCAC

Gene/Protein Characteristic Table for mKIAA1317

Features of the cloned DNA sequence

Features of the protein sequence