ROUGE

Gene/Protein Characteristic Table for mKIAA4056

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220462
Description :	Protein 4.1.
Clone Name :	mfj33372 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5048 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2511 bp

Genome contig ID gi65493515r_130620315
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
TCTTGCTTCTTGTATGGCATTTTTCAATAAACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGCCTGACTGTGAGGATTGATCCACTTTTAAAGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..2534
Length: 844 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH68138	96.8	Epb4.1 protein ...	Mus musculus
AAH79875	100.0	Epb4.1 protein ...	Mus musculus
Q6Q7P4	91.6	Protein 4.1; Ba...	Canis lupus fam...
BAD92886	89.0	Protein 4.1 var...	Homo sapiens
XP_001063302	79.3	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122251	4.2e-66	42.7	mKIAA0338
AK173080	2.4e-47	62.1	mKIAA0987
AK173198	1.3e-30	39.1	mKIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000299 284 296 PR00935 Band 4.1

IPR000299 348 361 PR00935 Band 4.1

IPR000299 361 381 PR00935 Band 4.1

IPR000299 422 438 PR00935 Band 4.1

HMMPfam IPR000299 253 442 PF00373 Band 4.1

IPR007477 630 695 PF04382 SAB

IPR008379 727 841 PF05902 4.1

HMMSmart IPR000299 247 442 SM00295 Band 4.1

ProfileScan NULL 138 239 PS50313 NULL

IPR000299 248 462 PS50057 Band 4.1

NULL 714 786 PS50325 NULL

ScanRegExp IPR000299 305 333 PS00660 Band 4.1

IPR000299 412 441 PS00661 Band 4.1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	284	296	PR00935	Band 4.1
IPR000299	348	361	PR00935	Band 4.1
IPR000299	361	381	PR00935	Band 4.1
IPR000299	422	438	PR00935	Band 4.1
HMMPfam	IPR000299	253	442	PF00373	Band 4.1
IPR007477	630	695	PF04382	SAB
IPR008379	727	841	PF05902	4.1
HMMSmart	IPR000299	247	442	SM00295	Band 4.1
ProfileScan	NULL	138	239	PS50313	NULL
IPR000299	248	462	PS50057	Band 4.1
NULL	714	786	PS50325	NULL
ScanRegExp	IPR000299	305	333	PS00660	Band 4.1
IPR000299	412	441	PS00661	Band 4.1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2511 bp
Genome contig ID	gi65493515r_130620315
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- TCTTGCTTCTTGTATGGCATTTTTCAATAAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCCTGACTGTGAGGATTGATCCACTTTTAAAGTT

Gene/Protein Characteristic Table for mKIAA4056

Features of the cloned DNA sequence

Features of the protein sequence