Gene/Protein Characteristic Table for mKIAA0987

Length: 3686 bp

Restriction map

Length of 3'UTR	1128 bp
Genome contig ID	gi65550231f_66923027
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- CACCGCATCTCGAAATAAAACTGGCAAATGCATTG
Flanking genome sequence (142541 - 142590)	----+----*----+----*----+----*----+----*----+----* AAAAGCTCTCGTCTTCCATGTGAAGTGATTGCTCTTTTGTGTGGTCTAGT

KIAA	Alignment based on:
KIAA0987	DNA sequence, AA sequence, Physical map

Coding region: 3..2558

Length: 851 aa

Entry Exp ID% Protein Source BAA90774 1.6e-182 92.1 type II brain 4... Rattus norvegicus XP_001914904 1.3e-161 84.9 similar to Band... Equus caballus CAH92695 3.3e-154 86.4 hypothetical pr... Pongo abelii Q9Y2J2 7e-154 86.3 Band 4.1-like p... Homo sapiens XP_512036 1e-153 85.7 erythrocyte mem... Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122251 2.1e-50 39.7 mKIAA0338 AK220462 9.4e-45 62.1 mKIAA4056 AK173198 1.3e-19 41.6 mKIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	14	27	PR00935	Band 4.1
	IPR000299	27	47	PR00935	Band 4.1
	IPR000299	88	104	PR00935	Band 4.1
HMMPfam	IPR000299	1	108	PF00373	Band 4.1
	IPR007477	494	561	PF04382	SAB
	IPR008379	766	851	PF05902	4.1
HMMSmart	IPR000299	1	108	SM00295	Band 4.1
ProfileScan	IPR000299	1	128	PS50057	Band 4.1
ScanRegExp	IPR000299	78	107	PS00661	Band 4.1

Method	From	To	amino acid sequence
SOSUI	20	42	IVSGRLPCSFVTLALLGSYTVQS
	432	454	FLFIFFFLLSASFSVPYALTLSF