Gene/Protein Characteristic Table for mKIAA0338

Length: 6086 bp

Restriction map

Length of 3'UTR	3361 bp
Genome contig ID	gi66880554f_155832874
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- AATCAATAAAAGTGAAATAAATGTGTTTGATGGTG
Flanking genome sequence (167278 - 167327)	----+----*----+----*----+----*----+----*----+----* AACCATGGACTCCCTCAGCCTCCCTCTCTCCCCCTCCCCTCTGCCTCTCC

KIAA	Alignment based on:
KIAA0338	DNA sequence, AA sequence, Physical map

Coding region: 2..2725

Length: 907 aa

Entry Exp ID% Protein Source Q9Z2H5 0 99.9 Band 4.1-like p... Mus musculus AAC68583 0 99.4 neuronal protei... Mus musculus BAG84711 0 99.3 erythrocyte pro... Mus musculus Q9WTP0 0 98.1 Band 4.1-like p... Rattus norvegicus AAH40259 0 94.8 EPB41L1 protein... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220462 8.6e-72 42.8 mKIAA4056 AK173080 6.2e-58 39.7 mKIAA0987 AK173198 1.9e-34 41.4 mKIAA1548 AK129262 0.00024 22.5 mKIAA1013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	158	170	PR00935	Band 4.1
	IPR000299	222	235	PR00935	Band 4.1
	IPR000299	235	255	PR00935	Band 4.1
	IPR000299	296	312	PR00935	Band 4.1
HMMPfam	IPR000299	127	316	PF00373	Band 4.1
	IPR007477	506	572	PF04382	SAB
	IPR008379	803	895	PF05902	4.1
HMMSmart	IPR000299	121	316	SM00295	Band 4.1
ProfileScan	IPR000299	122	336	PS50057	Band 4.1
ScanRegExp	IPR000299	179	207	PS00660	Band 4.1
	IPR000299	286	315	PS00661	Band 4.1

Method	From	To	amino acid sequence
-	-	-	-