| ROUGE |
Gene/Protein Characteristic Table for mKIAA0688 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173001 |
|---|---|
| a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4. aggrecanase-1. |
|
| mbh00872 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4281 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1474 bp Genome contig ID gi65488608f_171079383 PolyA signal sequence
(AAGAAA,-8)
CAAAGCAAAGCAAAGCAAAGCAAAGCAAAGAAAAGFlanking genome sequence None
KIAA Alignment based on: KIAA0688 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 122..1108, 1113..2807
Length: 893 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
