ROUGE

Gene/Protein Characteristic Table for mKIAA4060

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220464
Description :	ADAMTS-2 precursor.
Clone Name :	mbg16808 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4819 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1710 bp

Genome contig ID gi65527427f_50256122
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAATAAACTCAATAAAAAAGTTCAGTTCAACTGGG
Flanking genome sequence
(295067 - 295116)
----+----*----+----*----+----*----+----*----+----*
AGCTTGGGTTTGCTCGGCTGGTGGCTTGTTCCCATCACCTTCCTGGCAGG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..3106
Length: 1035 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8C9W3	99.7	A disintegrin a...	Mus musculus
XP_538574	90.7	similar to ADAM...	Canis lupus fam...
P79331	91.3	A disintegrin a...	Bos taurus
XP_001102920	91.6	ADAM metallopep...	Macaca mulatta
XP_848937	90.5	similar to ADAM...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC050834	1.2e-64	30.7	mKIAA1346
AK173338	3.7e-62	32.8	mKIAA2029
AK173001	8.7e-50	32.6	mKIAA0688
AK172978	6.3e-12	27.9	mKIAA0605
AK220376	1.9e-09	28.4	mKIAA1233

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002870 62 177 PF01562 Peptidase M12B

IPR001590 209 411 PF01421 Peptidase M12B

IPR000884 506 556 PF00090 Thrombospondin

IPR010294 664 778 PF05986 ADAM-TS Spacer 1

IPR000884 797 854 PF00090 Thrombospondin

IPR000884 859 916 PF00090 Thrombospondin

IPR000884 918 969 PF00090 Thrombospondin

HMMSmart IPR000884 505 557 SM00209 Thrombospondin

IPR000884 798 855 SM00209 Thrombospondin

IPR000884 858 917 SM00209 Thrombospondin

IPR000884 920 970 SM00209 Thrombospondin

ProfileScan IPR001590 207 411 PS50215 Peptidase M12B

IPR000884 502 558 PS50092 Thrombospondin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002870	62	177	PF01562	Peptidase M12B
IPR001590	209	411	PF01421	Peptidase M12B
IPR000884	506	556	PF00090	Thrombospondin
IPR010294	664	778	PF05986	ADAM-TS Spacer 1
IPR000884	797	854	PF00090	Thrombospondin
IPR000884	859	916	PF00090	Thrombospondin
IPR000884	918	969	PF00090	Thrombospondin
HMMSmart	IPR000884	505	557	SM00209	Thrombospondin
IPR000884	798	855	SM00209	Thrombospondin
IPR000884	858	917	SM00209	Thrombospondin
IPR000884	920	970	SM00209	Thrombospondin
ProfileScan	IPR001590	207	411	PS50215	Peptidase M12B
IPR000884	502	558	PS50092	Thrombospondin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1710 bp
Genome contig ID	gi65527427f_50256122
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAATAAACTCAATAAAAAAGTTCAGTTCAACTGGG
Flanking genome sequence (295067 - 295116)	----+--------+--------+--------+--------+----* AGCTTGGGTTTGCTCGGCTGGTGGCTTGTTCCCATCACCTTCCTGGCAGG

Gene/Protein Characteristic Table for mKIAA4060

Features of the cloned DNA sequence

Features of the protein sequence