ROUGE |
Gene/Protein Characteristic Table for mKIAA0605 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172978 |
---|---|
TSP1-repeats containing protein. | |
mpf03178 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6010 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 536 bp Genome contig ID gi66880554f_26929459 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CTGGTGCATGTTAATAAAGTGGCTGTATTTATGGGFlanking genome sequence
(111681 - 111730) ----+----*----+----*----+----*----+----*----+----*
AGCATACTGGGGTTTCTGTCACTTTGGGCAAAAATGGTGGGTAGCCTCAG
KIAA Alignment based on: KIAA0605 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 4266..5474
Length: 402 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000884 | 77 | 136 | PF00090 | Thrombospondin |
IPR000884 | 190 | 245 | PF00090 | Thrombospondin | |
IPR000884 | 308 | 358 | PF00090 | Thrombospondin | |
HMMSmart | IPR000884 | 76 | 137 | SM00209 | Thrombospondin |
IPR000884 | 139 | 189 | SM00209 | Thrombospondin | |
IPR000884 | 192 | 241 | SM00209 | Thrombospondin | |
IPR000884 | 248 | 306 | SM00209 | Thrombospondin | |
IPR000884 | 308 | 359 | SM00209 | Thrombospondin | |
ProfileScan | IPR000884 | 304 | 360 | PS50092 | Thrombospondin |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |