Gene/Protein Characteristic Table for mKIAA2023

Length: 6863 bp

Restriction map

Length of 3'UTR	1727 bp
Genome contig ID	gi65524842f_10927603
PolyA signal sequence (AATAAA,-23)	+----*----+----*----+----*----+---- ATACCTCAATTAAATAAATATTTTAGTGGAAAATG
Flanking genome sequence (165783 - 165832)	----+----*----+----*----+----*----+----*----+----* AAATTATGGATTGTTTTATTTCTAAGGTTTAGATCATATGAACTTTGGTT

KIAA	Alignment based on:
KIAA2023	DNA sequence, AA sequence, Physical map

Coding region: 73..5136

Length: 1687 aa

Entry Exp ID% Protein Source Q7TPQ3 0 100.0 E3 ubiquitin-pr... Mus musculus NP_766525 0 100.0 SNF2 histone li... Mus musculus AAO26654 0 99.9 SNF2 histone li... Mus musculus AAO26656 0 99.9 SNF2 histone li... Mus musculus EDL03522 0 100.0 SNF2 histone li... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129317 1.6e-05 27.0 mKIAA1259 AK220473 2.2e-05 27.0 mKIAA4075 AB093226 0.0004 29.8 mKIAA0308 AK122454 0.00048 33.1 mKIAA1122

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	315	991	PF00176	SNF2-related
	IPR005818	446	520	PF00538	Histone H1/H5
	IPR001650	1541	1626	PF00271	Helicase
HMMSmart	IPR011545	308	879	SM00487	DEAD/DEAH box helicase
	IPR005818	444	510	SM00526	Histone H1/H5
	IPR001965	664	711	SM00249	Zinc finger
	IPR001650	1546	1626	SM00490	Helicase
ProfileScan	IPR001841	1436	1483	PS50089	Zinc finger
ScanRegExp	IPR001965	665	710	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-