ROUGE |
Gene/Protein Characteristic Table for mKIAA1926 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK034300 |
---|---|
Hyaluronan and proteoglycan link protein 4 precursor. | |
mid09080 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3175 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1970 bp Genome contig ID gi65515060f_69137391 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AGCCCAAGTTCAATAAACCTTTGTTTTTTCTGGTGFlanking genome sequence
(106074 - 106123) ----+----*----+----*----+----*----+----*----+----*
AATGTGAAACAAGGCTGCCAGTCCCTGTCAGTGCAGTGGGCTTCTCGGTT
KIAA Alignment based on: KIAA1926 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1205
Length: 400 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |