| ROUGE |
Gene/Protein Characteristic Table for mKIAA0246 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AF290914 |
|---|---|
| Stabilin 1 precursor. | |
| mpm11210 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5499 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 128 bp Genome contig ID gi65540054r_29170854 PolyA signal sequence
(None)
TAAAAGTGCCCTCAGCGGATGTGGGCCATGTCACCFlanking genome sequence
(100000 - 99951)
AAGAAAGGGTGTCTTCATGCAGCCAGTGCACAGCTGGTCCATCCAGAGGG
KIAA Alignment based on: KIAA0246 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..5371
Length: 1789 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000538 | 1422 | 1518 | PD000918 | Link |
| HMMPfam | IPR006209 | 84 | 121 | PF00008 | EGF-like |
| IPR000782 | 219 | 339 | PF02469 | Beta-Ig-H3/fasciclin | |
| IPR000782 | 815 | 929 | PF02469 | Beta-Ig-H3/fasciclin | |
| IPR000782 | 955 | 1085 | PF02469 | Beta-Ig-H3/fasciclin | |
| IPR006209 | 1189 | 1224 | PF00008 | EGF-like | |
| IPR006209 | 1236 | 1268 | PF00008 | EGF-like | |
| IPR006209 | 1354 | 1391 | PF00008 | EGF-like | |
| IPR000538 | 1425 | 1518 | PF00193 | Link | |
| HMMSmart | IPR006210 | 2 | 35 | SM00181 | Type I EGF |
| IPR006210 | 40 | 79 | SM00181 | Type I EGF | |
| IPR006210 | 83 | 122 | SM00181 | Type I EGF | |
| IPR006210 | 126 | 165 | SM00181 | Type I EGF | |
| IPR006210 | 169 | 207 | SM00181 | Type I EGF | |
| IPR006210 | 513 | 549 | SM00181 | Type I EGF | |
| IPR006210 | 550 | 587 | SM00181 | Type I EGF | |
| IPR006210 | 597 | 631 | SM00181 | Type I EGF | |
| IPR006210 | 638 | 673 | SM00181 | Type I EGF | |
| IPR006210 | 677 | 715 | SM00181 | Type I EGF | |
| IPR006210 | 719 | 758 | SM00181 | Type I EGF | |
| IPR006210 | 762 | 801 | SM00181 | Type I EGF | |
| IPR006210 | 1188 | 1225 | SM00181 | Type I EGF | |
| IPR006210 | 1235 | 1269 | SM00181 | Type I EGF | |
| IPR006210 | 1277 | 1308 | SM00181 | Type I EGF | |
| IPR006210 | 1312 | 1349 | SM00181 | Type I EGF | |
| IPR006210 | 1353 | 1392 | SM00181 | Type I EGF | |
| IPR000538 | 1424 | 1519 | SM00445 | Link | |
| ProfileScan | NULL | 3 | 195 | PS50311 | NULL |
| IPR000782 | 207 | 337 | PS50213 | Beta-Ig-H3/fasciclin | |
| IPR000782 | 347 | 472 | PS50213 | Beta-Ig-H3/fasciclin | |
| NULL | 526 | 788 | PS50311 | NULL | |
| IPR000782 | 827 | 927 | PS50213 | Beta-Ig-H3/fasciclin | |
| IPR000782 | 943 | 1083 | PS50213 | Beta-Ig-H3/fasciclin | |
| NULL | 1164 | 1380 | PS50311 | NULL | |
| IPR000782 | 1540 | 1677 | PS50213 | Beta-Ig-H3/fasciclin | |
| ScanRegExp | IPR006209 | 65 | 78 | PS01186 | EGF-like |
| IPR006209 | 108 | 121 | PS01186 | EGF-like | |
| IPR001128 | 114 | 123 | PS00086 | Cytochrome P450 | |
| IPR006209 | 151 | 164 | PS01186 | EGF-like | |
| IPR006209 | 575 | 586 | PS00022 | EGF-like | |
| IPR006209 | 575 | 589 | PS01186 | EGF-like | |
| IPR002049 | 575 | 609 | PS01248 | Laminin-type EGF-like | |
| IPR006209 | 619 | 630 | PS00022 | EGF-like | |
| IPR006209 | 619 | 630 | PS01186 | EGF-like | |
| IPR006209 | 659 | 672 | PS01186 | EGF-like | |
| IPR006209 | 701 | 714 | PS01186 | EGF-like | |
| IPR006209 | 743 | 757 | PS01186 | EGF-like | |
| IPR007087 | 1164 | 1187 | PS00028 | Zinc finger | |
| IPR006209 | 1213 | 1224 | PS00022 | EGF-like | |
| IPR006209 | 1213 | 1227 | PS01186 | EGF-like | |
| IPR002049 | 1213 | 1247 | PS01248 | Laminin-type EGF-like | |
| IPR006209 | 1257 | 1268 | PS00022 | EGF-like | |
| IPR006209 | 1257 | 1268 | PS01186 | EGF-like | |
| IPR006209 | 1294 | 1307 | PS01186 | EGF-like | |
| IPR006209 | 1378 | 1391 | PS01186 | EGF-like | |
| IPR000538 | 1448 | 1493 | PS01241 | Link | |
| IPR006209 | 1525 | 1539 | PS01186 | EGF-like |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| SOSUI | 1644 | 1666 | SLVPLAPGAVVVSHVIVWDIMAF |
| 1695 | 1716 | ALSLGVVVTSGTLLGLVAGALY |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
