ROUGE

Gene/Protein Characteristic Table for mKIAA1916

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122570
Description :	Leucine-rich repeat LGI family member 2 precursor.
Clone Name :	mbg08812 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6211 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4442 bp

Genome contig ID gi65498774r_51244476
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCTGTAATCCTGTGAATAAAAAGTAGTAAATGCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACACCGCTTTGATCTCTGGTCTACTTTTAAAGAATGGATGCACCCACCG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1916 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1916	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1769
Length: 588 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAX51679	2e-213	100.0	LGI2B brain-der...	Mus musculus
AAI68885	2.4e-211	99.3	Lgi2 protein [R...	Rattus norvegicus
Q8N0V4	6.4e-208	97.6	Leucine-rich re...	Homo sapiens
CAD32305	1.7e-207	97.4	LGI1-like prote...	Homo sapiens
XP_001082016	4.6e-207	97.2	similar to leuc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122376	2.1e-10	29.5	mKIAA0813
AK032467	4.2e-10	30.1	mKIAA1580
AK172945	8.9e-10	30.6	mKIAA0405
AK129369	1.2e-09	29.6	mKIAA1469
AK220505	2.4e-08	29.7	mKIAA4141

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000104 1 15 PR00308 Antifreeze protein

IPR000104 15 26 PR00308 Antifreeze protein

IPR000104 29 38 PR00308 Antifreeze protein

IPR001611 178 191 PR00019 Leucine-rich repeat

IPR001611 199 212 PR00019 Leucine-rich repeat

HMMPfam IPR001611 129 152 PF00560 Leucine-rich repeat

IPR001611 153 176 PF00560 Leucine-rich repeat

IPR001611 177 200 PF00560 Leucine-rich repeat

IPR005492 263 303 PF03736 EPTP

IPR005492 451 492 PF03736 EPTP

HMMSmart IPR003591 127 150 SM00369 Leucine-rich repeat

IPR003591 151 174 SM00369 Leucine-rich repeat

IPR003591 175 198 SM00369 Leucine-rich repeat

IPR000483 210 259 SM00082 Cysteine-rich flanking region

ProfileScan NULL 2 40 PS50310 NULL

IPR003591 136 207 PS50506 Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 52 73 GGGALGLLLLSAACLIPPSAQV

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000104	1	15	PR00308	Antifreeze protein
IPR000104	15	26	PR00308	Antifreeze protein
IPR000104	29	38	PR00308	Antifreeze protein
IPR001611	178	191	PR00019	Leucine-rich repeat
IPR001611	199	212	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	129	152	PF00560	Leucine-rich repeat
IPR001611	153	176	PF00560	Leucine-rich repeat
IPR001611	177	200	PF00560	Leucine-rich repeat
IPR005492	263	303	PF03736	EPTP
IPR005492	451	492	PF03736	EPTP
HMMSmart	IPR003591	127	150	SM00369	Leucine-rich repeat
IPR003591	151	174	SM00369	Leucine-rich repeat
IPR003591	175	198	SM00369	Leucine-rich repeat
IPR000483	210	259	SM00082	Cysteine-rich flanking region
ProfileScan	NULL	2	40	PS50310	NULL
IPR003591	136	207	PS50506	Leucine-rich repeat

Method	From	To	amino acid sequence
SOSUI	52	73	GGGALGLLLLSAACLIPPSAQV

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4442 bp
Genome contig ID	gi65498774r_51244476
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCTGTAATCCTGTGAATAAAAAGTAGTAAATGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACCGCTTTGATCTCTGGTCTACTTTTAAAGAATGGATGCACCCACCG

Gene/Protein Characteristic Table for mKIAA1916

Features of the cloned DNA sequence

Features of the protein sequence