ROUGE |
Gene/Protein Characteristic Table for mKIAA1580 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK032467 |
---|---|
netrin-G1 ligand. | |
mbf00310 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2593 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 110 bp Genome contig ID gi66880554f_97072670 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGGCTAAATCTACTGTTTCAAAAAAGTGTCTTTACFlanking genome sequence
(263079 - 263128) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAACAAAAAGAAAAGAAATTTATTTATTAAAAATTCTATTGTG
KIAA Alignment based on: KIAA1580 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 561..2483
Length: 640 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 221 | 234 | PR00019 | Leucine-rich repeat |
IPR001611 | 266 | 279 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR000372 | 46 | 75 | PF01462 | Cysteine-rich flanking region |
IPR001611 | 77 | 100 | PF00560 | Leucine-rich repeat | |
IPR001611 | 101 | 124 | PF00560 | Leucine-rich repeat | |
IPR001611 | 125 | 148 | PF00560 | Leucine-rich repeat | |
IPR001611 | 149 | 172 | PF00560 | Leucine-rich repeat | |
IPR001611 | 173 | 197 | PF00560 | Leucine-rich repeat | |
IPR001611 | 198 | 219 | PF00560 | Leucine-rich repeat | |
IPR001611 | 220 | 243 | PF00560 | Leucine-rich repeat | |
IPR001611 | 268 | 291 | PF00560 | Leucine-rich repeat | |
NULL | 352 | 444 | PF07686 | NULL | |
NULL | 354 | 444 | PF07679 | NULL | |
IPR007110 | 368 | 428 | PF00047 | Immunoglobulin-like | |
HMMSmart | IPR000372 | 46 | 80 | SM00013 | Cysteine-rich flanking region |
IPR003591 | 79 | 98 | SM00369 | Leucine-rich repeat | |
NULL | 99 | 121 | SM00366 | NULL | |
IPR003591 | 99 | 122 | SM00369 | Leucine-rich repeat | |
NULL | 123 | 145 | SM00366 | NULL | |
IPR003591 | 123 | 146 | SM00369 | Leucine-rich repeat | |
NULL | 147 | 169 | SM00366 | NULL | |
IPR003591 | 147 | 170 | SM00369 | Leucine-rich repeat | |
NULL | 196 | 217 | SM00366 | NULL | |
IPR003591 | 196 | 217 | SM00369 | Leucine-rich repeat | |
NULL | 218 | 240 | SM00366 | NULL | |
IPR003591 | 218 | 241 | SM00369 | Leucine-rich repeat | |
IPR003591 | 242 | 265 | SM00369 | Leucine-rich repeat | |
NULL | 266 | 288 | SM00366 | NULL | |
IPR003591 | 266 | 289 | SM00369 | Leucine-rich repeat | |
IPR003599 | 360 | 444 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 366 | 433 | SM00408 | Immunoglobulin C2 type | |
IPR003596 | 370 | 428 | SM00406 | Immunoglobulin V-type | |
ProfileScan | IPR003591 | 108 | 179 | PS50506 | Leucine-rich repeat |
IPR003591 | 227 | 298 | PS50506 | Leucine-rich repeat | |
IPR007110 | 354 | 442 | PS50835 | Immunoglobulin-like | |
NULL | 410 | 510 | PS50325 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 22 | 44 | LFDPLLVVLLALQLLVVAGLVRA |
523 | 545 | MKTTKIIIGCFVAITLMAAVMLV |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |