ROUGE

Gene/Protein Characteristic Table for mKIAA0405

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172945
Description :	fibronectin leucine rich transmembrane protein 2.
Clone Name :	mbg12039 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6254 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4338 bp

Genome contig ID gi65532617f_91089593
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
TTGTTGATATATTCAGTAAAGGCTTATTTTAAAAG
Flanking genome sequence
(106256 - 106305)
----+----*----+----*----+----*----+----*----+----*
AAAACCTATTGTGTTTATCTGAGTAAATTCATCGAAATATAACTTGTATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0405 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0405	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1916
Length: 637 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC30900	100.0	unnamed protein...	Mus musculus
EDL81682	98.9	rCG20814 [Rattu...	Rattus norvegicus
O43155	97.8	Leucine-rich re...	Homo sapiens
AAI43937	97.6	FLRT2 protein [...	Homo sapiens
XP_001106330	97.5	fibronectin leu...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129369	7.5e-58	46.8	mKIAA1469
AK032467	6.7e-11	29.9	mKIAA1580
AK173186	5e-09	24.3	mKIAA1497
AK129367	9.2e-08	27.6	mKIAA1465
AK122376	1.6e-07	24.8	mKIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 138 151 PR00019 Leucine-rich repeat

IPR001611 252 265 PR00019 Leucine-rich repeat

HMMPfam IPR000372 12 39 PF01462 Cysteine-rich flanking region

IPR001611 41 65 PF00560 Leucine-rich repeat

IPR001611 87 110 PF00560 Leucine-rich repeat

IPR001611 111 136 PF00560 Leucine-rich repeat

IPR001611 137 156 PF00560 Leucine-rich repeat

IPR001611 158 181 PF00560 Leucine-rich repeat

IPR001611 182 207 PF00560 Leucine-rich repeat

IPR001611 230 253 PF00560 Leucine-rich repeat

IPR001611 254 277 PF00560 Leucine-rich repeat

IPR000483 313 338 PF01463 Cysteine-rich flanking region

IPR003961 397 479 PF00041 Fibronectin

HMMSmart IPR000372 12 44 SM00013 Cysteine-rich flanking region

IPR003591 84 108 SM00369 Leucine-rich repeat

IPR003591 109 134 SM00369 Leucine-rich repeat

IPR003591 136 158 SM00369 Leucine-rich repeat

IPR003591 159 179 SM00369 Leucine-rich repeat

IPR003591 180 205 SM00369 Leucine-rich repeat

IPR003591 229 251 SM00369 Leucine-rich repeat

IPR003591 252 275 SM00369 Leucine-rich repeat

IPR000483 287 338 SM00082 Cysteine-rich flanking region

ProfileScan IPR003591 118 188 PS50506 Leucine-rich repeat

IPR003591 215 284 PS50506 Leucine-rich repeat

ScanRegExp IPR001211 16 26 PS00119 Phospholipase A2

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	138	151	PR00019	Leucine-rich repeat
IPR001611	252	265	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	12	39	PF01462	Cysteine-rich flanking region
IPR001611	41	65	PF00560	Leucine-rich repeat
IPR001611	87	110	PF00560	Leucine-rich repeat
IPR001611	111	136	PF00560	Leucine-rich repeat
IPR001611	137	156	PF00560	Leucine-rich repeat
IPR001611	158	181	PF00560	Leucine-rich repeat
IPR001611	182	207	PF00560	Leucine-rich repeat
IPR001611	230	253	PF00560	Leucine-rich repeat
IPR001611	254	277	PF00560	Leucine-rich repeat
IPR000483	313	338	PF01463	Cysteine-rich flanking region
IPR003961	397	479	PF00041	Fibronectin
HMMSmart	IPR000372	12	44	SM00013	Cysteine-rich flanking region
IPR003591	84	108	SM00369	Leucine-rich repeat
IPR003591	109	134	SM00369	Leucine-rich repeat
IPR003591	136	158	SM00369	Leucine-rich repeat
IPR003591	159	179	SM00369	Leucine-rich repeat
IPR003591	180	205	SM00369	Leucine-rich repeat
IPR003591	229	251	SM00369	Leucine-rich repeat
IPR003591	252	275	SM00369	Leucine-rich repeat
IPR000483	287	338	SM00082	Cysteine-rich flanking region
ProfileScan	IPR003591	118	188	PS50506	Leucine-rich repeat
IPR003591	215	284	PS50506	Leucine-rich repeat
ScanRegExp	IPR001211	16	26	PS00119	Phospholipase A2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 517 539 PFLLAGLIGGAVIFVLVVLLSVF

Method	From	To	amino acid sequence
SOSUI	517	539	PFLLAGLIGGAVIFVLVVLLSVF

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4338 bp
Genome contig ID	gi65532617f_91089593
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TTGTTGATATATTCAGTAAAGGCTTATTTTAAAAG
Flanking genome sequence (106256 - 106305)	----+--------+--------+--------+--------+----* AAAACCTATTGTGTTTATCTGAGTAAATTCATCGAAATATAACTTGTATT

Gene/Protein Characteristic Table for mKIAA0405

Features of the cloned DNA sequence

Features of the protein sequence