ROUGE |
Gene/Protein Characteristic Table for mKIAA1469 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129369 |
---|---|
fibronectin leucine rich transmembrane protein 3. | |
mbj00677 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3334 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 432 bp Genome contig ID gi66880554r_140073183 PolyA signal sequence
(AATACA,-10) +----*----+----*----+----*----+----
ACAGGCCGTTTTTCACTTTGGTATTAATACAATGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAAAAAAAAAGAAACCTGGCTGGATGACAAAATAAATTTTAA
KIAA Alignment based on: KIAA1469 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 911..2902
Length: 663 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |