Gene/Protein Characteristic Table for mKIAA1870

Length: 3427 bp

Restriction map

Length of 3'UTR	851 bp
Genome contig ID	gi65493515f_62284391
PolyA signal sequence (AAGAAA,-8)	+----*----+----*----+----*----+---- AAAGGAACAAAAGGAAAAAAGAAAAGAAAGAAAAG
Flanking genome sequence (140962 - 141011)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAGAAAAAGAAAAAACAAAACAAAACAAAAAAATCCTCCTAGA

KIAA	Alignment based on:
KIAA1870	DNA sequence, AA sequence, Physical map

Coding region: 3..2576

Length: 857 aa

Entry Exp ID% Protein Source EDL31116 0 100.0 procollagen, ty... Mus musculus Q5QNQ9 0 100.0 Collagen alpha-... Mus musculus AAN87341 0 100.0 collagen type X... Mus musculus EDM10529 0 96.5 procollagen, ty... Rattus norvegicus Q80ZF0 0 96.4 Collagen alpha-... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220558 1.9e-44 42.2 mKIAA4231 AK131153 1.6e-33 46.1 mFLJ00201 AK173130 0.00012 25.7 mKIAA1205 AK129275 0.00026 25.1 mKIAA1064 AK220435 0.00086 48.1 mKIAA1983

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	182	234	PD000007	Collagen helix repeat
	IPR008161	480	565	PD000007	Collagen helix repeat
	IPR000885	746	857	PD002078	Fibrillar collagen
HMMPfam	IPR008160	9	68	PF01391	Collagen triple helix repeat
	IPR008160	69	128	PF01391	Collagen triple helix repeat
	IPR008160	129	188	PF01391	Collagen triple helix repeat
	IPR008160	189	248	PF01391	Collagen triple helix repeat
	IPR008160	252	311	PF01391	Collagen triple helix repeat
	IPR008160	315	375	PF01391	Collagen triple helix repeat
	IPR008160	376	435	PF01391	Collagen triple helix repeat
	IPR008160	436	495	PF01391	Collagen triple helix repeat
	IPR008160	496	555	PF01391	Collagen triple helix repeat
	IPR008160	556	615	PF01391	Collagen triple helix repeat
	IPR000885	673	856	PF01410	Fibrillar collagen
HMMSmart	IPR000885	656	857	SM00038	Fibrillar collagen
ProfileScan	IPR008160	1	615	PS50288	Collagen triple helix repeat
	NULL	3	613	PS50315	NULL
	IPR000694	16	618	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-