KIAA1870

Product ID	ORK04604
Accession No	AB058773
Description	collagen, type XXVII, alpha 1
Clone name	hh05136b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (5332 bp) Predicted protein sequence (832 aa)
Source	Human adult brain
Rouge ID	mKIAA1870 by Kazusa Mouse cDNA Project

Length: 5332 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	856 bp
Genome contig ID	gi89161216f_115870709
PolyA signal sequence (AAGAAA,-11)	+--------+--------+----*----+---- AATCTGCTAAGGAGGAAAAAAGAAAAGAAAAAAGG
Flanking genome sequence (242942 - 242991)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGCAAAACAAAAACAAAAACAAAAACCCTACCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	115970709	116113649	57	99.6	Perfect prediction

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZC6	100.0	Collagen alpha-...	Homo sapiens
EAW87414	99.3	collagen, type ...	Homo sapiens
EAW87412	99.3	collagen, type ...	Homo sapiens
XP_520208	96.6	collagen, type ...	Pan troglodytes
XP_602219	93.9	collagen, type ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040943	9.7e-07	40.6	KIAA1510
AB020631	1.1e-06	33.2	KIAA0824

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	149	185	PD000007	Collagen helix repeat
	IPR008161	266	285	PD000007	Collagen helix repeat
	IPR008161	393	419	PD000007	Collagen helix repeat
	IPR008161	445	475	PD000007	Collagen helix repeat
	IPR008161	498	537	PD000007	Collagen helix repeat
	IPR000885	721	832	PD002078	Fibrillar collagen
HMMPfam	IPR008160	59	118	PF01391	Collagen triple helix repeat
	IPR008160	131	190	PF01391	Collagen triple helix repeat
	IPR008160	191	250	PF01391	Collagen triple helix repeat
	IPR008160	251	310	PF01391	Collagen triple helix repeat
	IPR008160	312	371	PF01391	Collagen triple helix repeat
	IPR008160	384	443	PF01391	Collagen triple helix repeat
	IPR008160	450	509	PF01391	Collagen triple helix repeat
	IPR008160	534	593	PF01391	Collagen triple helix repeat
	IPR000885	648	831	PF01410	Fibrillar collagen
HMMSmart	IPR000885	631	832	SM00038	Fibrillar collagen

Primer_f	TTACACTACCTCAGCAACCTC
Primer_r	ATGAGTGAAGTTGCAGGAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-