Gene/Protein Characteristic Table for mKIAA1983

Length: 1301 bp

Restriction map

Length of 3'UTR	20 bp
Genome contig ID	gi65551972r_66193939
PolyA signal sequence (None)	+----*----+----*----+----*----+---- AATTTTTATCCATAGCACATCCCATATCCTCACGC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* CACCAGAAGAGAAGCATGCCTTCGACCTTCCCCTTACTCTGTTTCCAAAC

KIAA	Alignment based on:
KIAA1983	DNA sequence, AA sequence, Physical map

Coding region: 1..1281

Length: 426 aa

Entry Exp ID% Protein Source EDL09670 2.6e-142 99.8 collagen and ca... Mus musculus EDL09671 3.1e-141 99.3 collagen and ca... Mus musculus BAC28962 1.3e-136 99.8 unnamed protein... Mus musculus BAC25916 2.5e-136 99.5 unnamed protein... Mus musculus Q3MI99 6.3e-136 99.5 Collagen and ca... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220558 5.7e-05 36.9 mKIAA4231 AK131153 0.00017 46.5 mFLJ00201 AK173283 0.00033 48.1 mKIAA1870

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001438	108	119	PR00010	Type II EGF-like signature
	IPR001438	174	184	PR00010	Type II EGF-like signature
HMMPfam	IPR001881	153	193	PF07645	EGF-like calcium-binding
	IPR006209	157	193	PF00008	EGF-like
HMMSmart	IPR001881	108	152	SM00179	EGF-like calcium-binding
	IPR006210	111	152	SM00181	Type I EGF
	IPR001881	153	194	SM00179	EGF-like calcium-binding
	IPR006210	156	194	SM00181	Type I EGF
ProfileScan	NULL	153	194	PS50034	NULL
	IPR008160	266	353	PS50288	Collagen triple helix repeat
	IPR000694	266	352	PS50099	Proline-rich region
	NULL	267	353	PS50315	NULL
ScanRegExp	IPR001881	153	178	PS01187	EGF-like calcium-binding
	IPR000152	169	180	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR006209	178	193	PS01186	EGF-like

Method	From	To	amino acid sequence
-	-	-	-