ROUGE

Gene/Protein Characteristic Table for mKIAA1205

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173130
Description :
Clone Name :	mpf00780 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5769 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 222 bp

Genome contig ID gi65511124r_39004799
PolyA signal sequence
(TATAAA,-21)
+----*----+----*----+----*----+----
TATTTATATATATGTATAAATGTCTATTTAGTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGCCCTGTCCCCTGGCCCAGCCCCCCCAACACGGCCATCGCCCCTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1205 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1205	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..5547
Length: 1848 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_778187	100.0	proline rich 12...	Mus musculus
XP_001080668	97.5	similar to CG17...	Rattus norvegicus
NP_065770	92.4	proline rich 12...	Homo sapiens
XP_541492	91.3	similar to CG17...	Canis lupus fam...
XP_341853	94.3	similar to CG17...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220466	0.00065	38.0	mKIAA4062

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 972 983 PR00929 HMG-I and HMG-Y

IPR000637 1004 1014 PR00929 HMG-I and HMG-Y

ProfileScan IPR000694 29 117 PS50099 Proline-rich region

NULL 146 495 PS50315 NULL

IPR000694 574 1352 PS50099 Proline-rich region

IPR000694 1473 1544 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	972	983	PR00929	HMG-I and HMG-Y
IPR000637	1004	1014	PR00929	HMG-I and HMG-Y
ProfileScan	IPR000694	29	117	PS50099	Proline-rich region
NULL	146	495	PS50315	NULL
IPR000694	574	1352	PS50099	Proline-rich region
IPR000694	1473	1544	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	222 bp
Genome contig ID	gi65511124r_39004799
PolyA signal sequence (TATAAA,-21)	+--------+--------+----*----+---- TATTTATATATATGTATAAATGTCTATTTAGTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGCCCTGTCCCCTGGCCCAGCCCCCCCAACACGGCCATCGCCCCTGC

Gene/Protein Characteristic Table for mKIAA1205

Features of the cloned DNA sequence

Features of the protein sequence