ROUGE |
Gene/Protein Characteristic Table for mKIAA1976 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122575 |
---|---|
netrin receptor Unc5h1. unc5 homolog (C. elegans) 1. |
|
mbh03993 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4294 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2961 bp Genome contig ID gi65535943f_53458987 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATGTGAATGTAAATAAATTATATATATATATTGCTFlanking genome sequence
(156362 - 156411) ----+----*----+----*----+----*----+----*----+----*
AACCGGAGTGTCGCTTCTCTTGCAAAGCCATTAGGTGTGGGCAGACGGCT
KIAA Alignment based on: KIAA1976 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2263..3249
Length: 328 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |