ROUGE |
Gene/Protein Characteristic Table for mKIAA1675 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173230 |
---|---|
transcription factor MEL1. | |
mia50030 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2620 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 496 bp Genome contig ID gi65493515r_152712655 PolyA signal sequence
(AATAGA,-24) +----*----+----*----+----*----+----
GTTTTAAAAAAAATAGACGGTATTTTTTAAAAATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGACTTGCAAAATGTTTTTTTAAAAGTAATTTTGC
KIAA Alignment based on: KIAA1675 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..2124
Length: 707 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |