Gene/Protein Characteristic Table for mKIAA1388

Length: 5287 bp

Restriction map

Length of 3'UTR	3714 bp
Genome contig ID	gi65515060r_94508290
PolyA signal sequence (AATAAA,-21)	+----*----+----*----+----*----+---- CCATGTTGCTCTGTAATAAACATTACTGTTACTTT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATAGTAGAAATTTCATTCTGTCCAGATAGATATATCTGCATGGTTCTGGA

KIAA	Alignment based on:
KIAA1388	DNA sequence, AA sequence, Physical map

Coding region: 2..1573

Length: 523 aa

Entry Exp ID% Protein Source Q9ERR8 6.9e-208 100.0 Zinc finger pro... Mus musculus BAC34912 1e-207 99.8 unnamed protein... Mus musculus EDL87291 1.4e-206 98.9 rCG39161 [Rattu... Rattus norvegicus XP_001100953 1.9e-202 96.4 zinc finger pro... Macaca mulatta Q9P2F9 7.8e-202 96.2 Zinc finger pro... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173170 4.3e-38 37.2 mKIAA1431 AK173240 3.9e-37 43.8 mKIAA1710 AK220539 2.5e-34 39.1 mKIAA4196 AK122579 6.7e-30 30.8 mKIAA3006 AK173284 7e-30 38.9 mKIAA1874

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	171	194	PD000003	Zinc finger
	IPR007087	256	279	PD000003	Zinc finger
	IPR007087	428	450	PD000003	Zinc finger
FPrintScan	IPR007086	170	183	PR00048	Zinc finger
	IPR007086	442	451	PR00048	Zinc finger
HMMPfam	IPR007087	73	95	PF00096	Zinc finger
	IPR007087	143	165	PF00096	Zinc finger
	IPR007087	171	193	PF00096	Zinc finger
	IPR007087	199	221	PF00096	Zinc finger
	IPR007087	256	278	PF00096	Zinc finger
	IPR007087	284	306	PF00096	Zinc finger
	IPR007087	312	334	PF00096	Zinc finger
	IPR007087	369	391	PF00096	Zinc finger
	IPR007087	427	449	PF00096	Zinc finger
	IPR007087	455	477	PF00096	Zinc finger
HMMSmart	IPR007087	45	65	SM00355	Zinc finger
	IPR007087	73	95	SM00355	Zinc finger
	IPR007087	143	165	SM00355	Zinc finger
	IPR007087	171	193	SM00355	Zinc finger
	IPR007087	199	221	SM00355	Zinc finger
	IPR007087	256	278	SM00355	Zinc finger
	IPR007087	284	306	SM00355	Zinc finger
	IPR007087	312	334	SM00355	Zinc finger
	IPR007087	340	360	SM00355	Zinc finger
	IPR007087	369	391	SM00355	Zinc finger
	IPR007087	399	419	SM00355	Zinc finger
	IPR007087	427	449	SM00355	Zinc finger
	IPR007087	455	477	SM00355	Zinc finger
	IPR007087	483	505	SM00355	Zinc finger
ProfileScan	IPR007087	45	72	PS50157	Zinc finger
	IPR007087	73	100	PS50157	Zinc finger
	IPR007087	143	170	PS50157	Zinc finger
	IPR007087	171	198	PS50157	Zinc finger
	IPR007087	199	226	PS50157	Zinc finger
	IPR007087	228	255	PS50157	Zinc finger
	IPR007087	256	283	PS50157	Zinc finger
	IPR007087	284	311	PS50157	Zinc finger
	IPR007087	312	339	PS50157	Zinc finger
	IPR007087	340	368	PS50157	Zinc finger
	IPR007087	369	396	PS50157	Zinc finger
	IPR007087	399	426	PS50157	Zinc finger
	IPR007087	427	454	PS50157	Zinc finger
	IPR007087	455	482	PS50157	Zinc finger
	IPR007087	483	510	PS50157	Zinc finger
ScanRegExp	IPR007087	19	41	PS00028	Zinc finger
	IPR007087	75	95	PS00028	Zinc finger
	IPR007087	145	165	PS00028	Zinc finger
	IPR007087	173	193	PS00028	Zinc finger
	IPR007087	201	221	PS00028	Zinc finger
	IPR007087	258	278	PS00028	Zinc finger
	IPR007087	286	306	PS00028	Zinc finger
	IPR007087	314	334	PS00028	Zinc finger
	IPR007087	371	391	PS00028	Zinc finger
	IPR007087	429	449	PS00028	Zinc finger
	IPR007087	457	477	PS00028	Zinc finger
	IPR007087	485	505	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-