KIAA1675

Product ID	ORK01176
Accession No	AB051462
Description	PR domain containing 16, transcript variant 1
Clone name	ae00102
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8671 bp) Predicted protein sequence (1286 aa)
HaloTag ORF Clone	FHC01176
Flexi ORF Clone	FXC01176
Source	Human brain (amygdala)
Rouge ID	mKIAA1675 by Kazusa Mouse cDNA Project
Note	We replaced fg05423, former representative clones for KIAA1675 with ae00102. (2002/5/10)

Length: 8671 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4808 bp
Genome contig ID	gi89161185f_2875652
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAGATTGATATGCAATAAATCTGTGTGCTTTTCT
Flanking genome sequence (469393 - 469442)	----+--------+--------+--------+--------+----* AAGCCTCGGTGCCCGCGAGCTTCATTGAGGGAGAGGCCCCAGGCCTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	2975652	3345043	17	99.3	Perfect prediction

Length: 1286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HAZ2	100.0	PR domain zinc ...	Homo sapiens
CAH71132	99.9	PR domain conta...	Homo sapiens
NP_071397	99.8	PR domain conta...	Homo sapiens
CAH71134	99.8	PR domain conta...	Homo sapiens
AAG33382	99.5	PR-domain-conta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075862	2.3e-10	34.8	KIAA1982
AB075842	2.8e-10	36.5	KIAA1962
AB058730	3.1e-10	38.7	KIAA1827
AB095924	3.5e-10	36.1	KIAA2003
AB051497	7.8e-10	33.3	KIAA1710

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	319	338	PD000003	Zinc finger
	IPR007087	376	399	PD000003	Zinc finger
	IPR007087	961	984	PD000003	Zinc finger
	IPR007087	989	1012	PD000003	Zinc finger
HMMPfam	IPR007087	240	263	PF00096	Zinc finger
	IPR007087	291	313	PF00096	Zinc finger
	IPR007087	319	341	PF00096	Zinc finger
	IPR007087	347	370	PF00096	Zinc finger
	IPR007087	376	398	PF00096	Zinc finger
	IPR007087	404	426	PF00096	Zinc finger
	IPR007087	433	455	PF00096	Zinc finger
	IPR007087	961	983	PF00096	Zinc finger
	IPR007087	989	1012	PF00096	Zinc finger
	IPR007087	1018	1040	PF00096	Zinc finger
HMMSmart	IPR001214	94	227	SM00317	SET
	IPR015880	240	260	SM00355	Zinc finger
	IPR015880	291	313	SM00355	Zinc finger
	IPR015880	319	341	SM00355	Zinc finger
	IPR015880	347	370	SM00355	Zinc finger
	IPR015880	376	398	SM00355	Zinc finger
	IPR015880	404	426	SM00355	Zinc finger
	IPR015880	433	460	SM00355	Zinc finger
	IPR015880	961	983	SM00355	Zinc finger
	IPR015880	989	1012	SM00355	Zinc finger
	IPR015880	1018	1040	SM00355	Zinc finger
ProfileScan	IPR001214	93	225	PS50280	SET
	IPR007087	240	267	PS50157	Zinc finger
	IPR007087	291	318	PS50157	Zinc finger
	IPR007087	319	346	PS50157	Zinc finger
	IPR007087	347	375	PS50157	Zinc finger
	IPR007087	376	403	PS50157	Zinc finger
	IPR007087	404	431	PS50157	Zinc finger
	IPR007087	433	460	PS50157	Zinc finger
	IPR007087	961	988	PS50157	Zinc finger
	IPR007087	989	1017	PS50157	Zinc finger
	IPR007087	1018	1045	PS50157	Zinc finger
ScanRegExp	IPR007087	293	313	PS00028	Zinc finger
	IPR007087	321	341	PS00028	Zinc finger
	IPR007087	349	370	PS00028	Zinc finger
	IPR007087	378	398	PS00028	Zinc finger
	IPR007087	406	426	PS00028	Zinc finger
	IPR007087	963	983	PS00028	Zinc finger
	IPR007087	991	1012	PS00028	Zinc finger
	IPR007087	1020	1042	PS00028	Zinc finger

Primer_f	TTAATACGGAAATCGCTGTGG
Primer_r	TAACCTCCAAATCGGCTTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTCTTATTGCGCCAGGGTGAC
Primer_r	GGTGAAAAGTATAGGGTAGGC
PCR product length	147 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles