| ROUGE |
Gene/Protein Characteristic Table for mKIAA1710 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173240 |
|---|---|
| Zinc finger protein 46. | |
| mbg19468 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4553 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2656 bp Genome contig ID gi65493515f_135067340 PolyA signal sequence
(ATTAAA,-24)
AATATTCTATAATTAAAGGTATAATTTTTAAACTCFlanking genome sequence None
KIAA Alignment based on: KIAA1710 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 512..1897
Length: 461 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR007087 | 129 | 152 | PD000003 | Zinc finger |
| IPR007087 | 157 | 180 | PD000003 | Zinc finger | |
| IPR007087 | 185 | 208 | PD000003 | Zinc finger | |
| IPR007087 | 213 | 236 | PD000003 | Zinc finger | |
| IPR007087 | 241 | 264 | PD000003 | Zinc finger | |
| IPR007087 | 269 | 292 | PD000003 | Zinc finger | |
| IPR007087 | 297 | 320 | PD000003 | Zinc finger | |
| IPR007087 | 325 | 348 | PD000003 | Zinc finger | |
| IPR007087 | 353 | 376 | PD000003 | Zinc finger | |
| IPR007087 | 381 | 404 | PD000003 | Zinc finger | |
| IPR007087 | 409 | 432 | PD000003 | Zinc finger | |
| IPR007087 | 437 | 460 | PD000003 | Zinc finger | |
| FPrintScan | IPR007086 | 240 | 253 | PR00048 | Zinc finger |
| IPR007086 | 256 | 265 | PR00048 | Zinc finger | |
| HMMPfam | IPR001909 | 5 | 45 | PF01352 | KRAB box |
| IPR007087 | 129 | 151 | PF00096 | Zinc finger | |
| IPR007087 | 157 | 179 | PF00096 | Zinc finger | |
| IPR007087 | 185 | 207 | PF00096 | Zinc finger | |
| IPR007087 | 213 | 235 | PF00096 | Zinc finger | |
| IPR007087 | 241 | 263 | PF00096 | Zinc finger | |
| IPR007087 | 269 | 291 | PF00096 | Zinc finger | |
| IPR007087 | 297 | 319 | PF00096 | Zinc finger | |
| IPR007087 | 325 | 347 | PF00096 | Zinc finger | |
| IPR007087 | 353 | 375 | PF00096 | Zinc finger | |
| IPR007087 | 381 | 403 | PF00096 | Zinc finger | |
| IPR007087 | 409 | 431 | PF00096 | Zinc finger | |
| IPR007087 | 437 | 459 | PF00096 | Zinc finger | |
| HMMSmart | IPR001909 | 5 | 66 | SM00349 | KRAB box |
| IPR007087 | 129 | 151 | SM00355 | Zinc finger | |
| IPR007087 | 157 | 179 | SM00355 | Zinc finger | |
| IPR007087 | 185 | 207 | SM00355 | Zinc finger | |
| IPR007087 | 213 | 235 | SM00355 | Zinc finger | |
| IPR007087 | 241 | 263 | SM00355 | Zinc finger | |
| IPR007087 | 269 | 291 | SM00355 | Zinc finger | |
| IPR007087 | 297 | 319 | SM00355 | Zinc finger | |
| IPR007087 | 325 | 347 | SM00355 | Zinc finger | |
| IPR007087 | 353 | 375 | SM00355 | Zinc finger | |
| IPR007087 | 381 | 403 | SM00355 | Zinc finger | |
| IPR007087 | 409 | 431 | SM00355 | Zinc finger | |
| IPR007087 | 437 | 459 | SM00355 | Zinc finger | |
| ProfileScan | IPR001909 | 5 | 109 | PS50805 | KRAB box |
| IPR007087 | 129 | 156 | PS50157 | Zinc finger | |
| IPR007087 | 157 | 184 | PS50157 | Zinc finger | |
| IPR007087 | 185 | 212 | PS50157 | Zinc finger | |
| IPR007087 | 213 | 240 | PS50157 | Zinc finger | |
| IPR007087 | 241 | 268 | PS50157 | Zinc finger | |
| IPR007087 | 269 | 296 | PS50157 | Zinc finger | |
| IPR007087 | 297 | 324 | PS50157 | Zinc finger | |
| IPR007087 | 325 | 352 | PS50157 | Zinc finger | |
| IPR007087 | 353 | 380 | PS50157 | Zinc finger | |
| IPR007087 | 381 | 408 | PS50157 | Zinc finger | |
| IPR007087 | 409 | 436 | PS50157 | Zinc finger | |
| IPR007087 | 437 | 461 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 131 | 151 | PS00028 | Zinc finger |
| IPR007087 | 159 | 179 | PS00028 | Zinc finger | |
| IPR007087 | 187 | 207 | PS00028 | Zinc finger | |
| IPR007087 | 215 | 235 | PS00028 | Zinc finger | |
| IPR007087 | 243 | 263 | PS00028 | Zinc finger | |
| IPR007087 | 271 | 291 | PS00028 | Zinc finger | |
| IPR007087 | 299 | 319 | PS00028 | Zinc finger | |
| IPR007087 | 327 | 347 | PS00028 | Zinc finger | |
| IPR007087 | 355 | 375 | PS00028 | Zinc finger | |
| IPR007087 | 383 | 403 | PS00028 | Zinc finger | |
| IPR007087 | 411 | 431 | PS00028 | Zinc finger | |
| IPR007087 | 439 | 459 | PS00028 | Zinc finger |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
