Gene/Protein Characteristic Table for mKIAA1619

Length: 4117 bp

Restriction map

Length of 3'UTR	251 bp
Genome contig ID	gi65553144f_44433722
PolyA signal sequence (AATAAA,-18)	+----*----+----*----+----*----+---- GTTTCATAAGCCACCCAAATAAATACTCACCCCAC
Flanking genome sequence (107976 - 108025)	----+----*----+----*----+----*----+----*----+----* AGATGCTGAGTTTGTGTTCTCTGTGCTGGTGCGGGAGAGCAAGACAAGCG

KIAA	Alignment based on:
KIAA1619	DNA sequence, AA sequence, Physical map

Coding region: 3144..3866

Length: 240 aa

Entry Exp ID% Protein Source EDL41942 1.5e-98 100.0 sema domain, im... Mus musculus Q9WUH7 1.6e-98 100.0 Semaphorin-4G; ... Mus musculus EDL94295 1e-94 95.8 sema domain, im... Rattus norvegicus XP_543973 8.3e-92 92.5 similar to sema... Canis lupus fam... EAW49802 2.5e-90 91.6 sema domain, im... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC049780 3.2e-29 41.4 mKIAA4225 AK173249 5.1e-22 33.5 mKIAA1745 AK173247 1.8e-19 53.1 mKIAA1739 D85028 1.8e-19 37.4 mKIAA4055 AK122515 1e-10 26.9 mKIAA1479

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-