ROUGE |
Gene/Protein Characteristic Table for mKIAA4055 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | D85028 |
---|---|
Semaphorin 3A precursor. | |
mfj06069 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5503 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2966 bp Genome contig ID gi65498774f_12736560 PolyA signal sequence
(AATACA,-25) +----*----+----*----+----*----+----
TCAGTTGCTAAATACACATTTCTTCAAAATATTTGFlanking genome sequence
(303482 - 303531) ----+----*----+----*----+----*----+----*----+----*
AATTCAGATGTCTTTACTGTTCCATATAACATATGGTATTGAGGAAGATA
Features of the protein sequence |
Description | |
Coding region: 153..2534
Length: 794 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |