Gene/Protein Characteristic Table for mKIAA4225

Length: 4375 bp

Restriction map

Length of 3'UTR	1362 bp
Genome contig ID	gi65535943r_50154932
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- AAAAGTACCCAAATAAACCAGAAGCTTTATCGTTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ACTGGGCCAGCCTTTGCCTTAGTGTGGAGGCTGGGGGCGGTGGGGTGTCC

Coding region: 407..3010

Length: 868 aa

Entry Exp ID% Protein Source AAH49780 0 100.0 Sema domain, im... Mus musculus O09126 0 99.7 Semaphorin-4D; ... Mus musculus BAE21302 0 99.5 unnamed protein... Mus musculus XP_225215 0 93.3 similar to sema... Rattus norvegicus BAC40480 0 99.9 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173247 6.2e-70 46.2 mKIAA1739 AK173249 9.5e-67 42.5 mKIAA1745 D85028 7.3e-56 37.2 mKIAA4055 AK122515 2.1e-35 35.5 mKIAA1479 AK129116 1.8e-33 33.5 mKIAA0331

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	57	489	PF01403	Semaphorin/CD100 antigen
	IPR002165	509	561	PF01437	Plexin
	NULL	536	654	PF07686	NULL
HMMSmart	IPR003659	509	561	SM00423	Plexin/semaphorin/integrin
	IPR003598	574	638	SM00408	Immunoglobulin C2 type
ProfileScan	IPR007110	576	643	PS50835	Immunoglobulin-like

Method	From	To	amino acid sequence
SOSUI	11	33	CAPVRGLFLALVVVLRTAVAFAP
	739	761	NRLLMSLLLFIFVLFLCLFSYNC