ROUGE |
Gene/Protein Characteristic Table for mKIAA1479 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122515 |
---|---|
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D isoform 1. semaphorin 6D. |
|
mbg01940 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6161 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2460 bp Genome contig ID gi66880554f_123503823 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CGCATGTAAAGTCAAAATAAAATATCCAAGTCATTFlanking genome sequence
(677802 - 677851) ----+----*----+----*----+----*----+----*----+----*
ACATCCTGCCTTTTGATGTTAACAGGTTTGCACTGCGTCATGCTTTTATG
KIAA Alignment based on: KIAA1479 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 672..3701
Length: 1009 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |