ROUGE |
Gene/Protein Characteristic Table for mKIAA1611 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173216 |
---|---|
mph00982 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3825 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1712 bp Genome contig ID gi65550231f_18780850 PolyA signal sequence
(AGTAAA,-22) +----*----+----*----+----*----+----
TGTAACTAATGAAAGTAAAGCTTTTATTTTCCTATFlanking genome sequence
(119824 - 119873) ----+----*----+----*----+----*----+----*----+----*
AAATGAATTTGTTTTTCTTTTGTTTGTATACTTTTTGCATATGCGTACAC
KIAA Alignment based on: KIAA1611 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 145..423, 710..2104
Length: 558 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |