| ROUGE |
Gene/Protein Characteristic Table for mKIAA1541 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129386 |
|---|---|
| Serine/threonine protein phosphatase 2A, 55 kDa regulatory subunit B, delta isoform. | |
| mnh10009 [Vector Info] | |
| Source : | Mouse NKT cells |
| Note : | We replaced mpj01439, former representative clones for mKIAA1541 with mnh10009. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2078 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 566 bp Genome contig ID gi65511124f_133132602 PolyA signal sequence
(None)
ATAAACACAACACACTGTGAAGTGTTTTTAAACCCFlanking genome sequence
(136697 - 136746)
AAATGCCACTGCAGTCTTTATTTGTTTCAGTTGCACATAATTATTCAGGA
KIAA Alignment based on: KIAA1541 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 97..1512
Length: 471 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000009 | 59 | 79 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 |
| IPR000009 | 94 | 122 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 123 | 151 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 200 | 227 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 228 | 255 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 256 | 284 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 285 | 312 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 313 | 340 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 341 | 366 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 367 | 393 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| IPR000009 | 437 | 466 | PR00600 | Protein phosphatase 2A regulatory subunit PR55 | |
| HMMPfam | IPR001680 | 43 | 80 | PF00400 | WD-40 repeat |
| IPR001680 | 109 | 147 | PF00400 | WD-40 repeat | |
| IPR001680 | 191 | 228 | PF00400 | WD-40 repeat | |
| IPR001680 | 241 | 279 | PF00400 | WD-40 repeat | |
| IPR001680 | 300 | 336 | PF00400 | WD-40 repeat | |
| HMMSmart | IPR001680 | 45 | 80 | SM00320 | WD-40 repeat |
| IPR001680 | 107 | 147 | SM00320 | WD-40 repeat | |
| IPR001680 | 189 | 228 | SM00320 | WD-40 repeat | |
| IPR001680 | 239 | 279 | SM00320 | WD-40 repeat | |
| IPR001680 | 298 | 336 | SM00320 | WD-40 repeat | |
| IPR001680 | 363 | 394 | SM00320 | WD-40 repeat | |
| IPR001680 | 430 | 467 | SM00320 | WD-40 repeat | |
| ScanRegExp | IPR000009 | 107 | 121 | PS01024 | Protein phosphatase 2A regulatory subunit PR55 |
| IPR000009 | 198 | 212 | PS01025 | Protein phosphatase 2A regulatory subunit PR55 |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
