| ROUGE |
Gene/Protein Characteristic Table for mKIAA1541 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129386 |
|---|---|
| Serine/threonine protein phosphatase 2A, 55 kDa regulatory subunit B, delta isoform. | |
| mnh10009 [Vector Info] | |
| Source : | Mouse NKT cells |
| Note : | We replaced mpj01439, former representative clones for mKIAA1541 with mnh10009. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2078 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 566 bp Genome contig ID gi65511124f_133132602 PolyA signal sequence
(None)
ATAAACACAACACACTGTGAAGTGTTTTTAAACCCFlanking genome sequence
(136697 - 136746)
AAATGCCACTGCAGTCTTTATTTGTTTCAGTTGCACATAATTATTCAGGA
KIAA Alignment based on: KIAA1541 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 97..1512
Length: 471 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
