ROUGE

Gene/Protein Characteristic Table for mKIAA4213

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220192
Description :
Clone Name :	mpj01439 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2327 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 655 bp

Genome contig ID gi65540054r_61446539
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGGCTGTAATCACTCCTTGCCATGTCTGGCACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATAAGGAAAAAAAAAAAAACTACTACTGAATAAAAGTGACAAAGAAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 143..1669
Length: 509 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6P1F6	5.5e-160	100.0	Serine/threonin...	Mus musculus
AAV38550	5.5e-160	100.0	protein phospha...	synthetic construct
P36876	6.3e-160	99.8	Serine/threonin...	Rattus norvegicus
AAO85219	2e-159	99.8	lung cancer-rel...	Homo sapiens
CAG31349	2.3e-159	99.3	hypothetical pr...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129386	3e-103	87.2	mKIAA1541

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000009 97 117 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 132 160 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 161 189 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 238 265 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 266 293 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 294 322 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 323 350 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 351 378 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 379 404 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 405 431 PR00600 Protein phosphatase 2A regulatory subunit PR55

IPR000009 475 504 PR00600 Protein phosphatase 2A regulatory subunit PR55

HMMPfam IPR001680 81 118 PF00400 WD-40 repeat

IPR001680 147 185 PF00400 WD-40 repeat

IPR001680 229 266 PF00400 WD-40 repeat

IPR001680 279 317 PF00400 WD-40 repeat

IPR001680 338 374 PF00400 WD-40 repeat

HMMSmart IPR001680 83 118 SM00320 WD-40 repeat

IPR001680 145 185 SM00320 WD-40 repeat

IPR001680 227 266 SM00320 WD-40 repeat

IPR001680 277 317 SM00320 WD-40 repeat

IPR001680 336 374 SM00320 WD-40 repeat

IPR001680 401 432 SM00320 WD-40 repeat

IPR001680 468 505 SM00320 WD-40 repeat

ProfileScan IPR000694 2 50 PS50099 Proline-rich region

ScanRegExp IPR000009 145 159 PS01024 Protein phosphatase 2A regulatory subunit PR55

IPR000009 236 250 PS01025 Protein phosphatase 2A regulatory subunit PR55

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000009	97	117	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	132	160	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	161	189	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	238	265	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	266	293	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	294	322	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	323	350	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	351	378	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	379	404	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	405	431	PR00600	Protein phosphatase 2A regulatory subunit PR55
IPR000009	475	504	PR00600	Protein phosphatase 2A regulatory subunit PR55
HMMPfam	IPR001680	81	118	PF00400	WD-40 repeat
IPR001680	147	185	PF00400	WD-40 repeat
IPR001680	229	266	PF00400	WD-40 repeat
IPR001680	279	317	PF00400	WD-40 repeat
IPR001680	338	374	PF00400	WD-40 repeat
HMMSmart	IPR001680	83	118	SM00320	WD-40 repeat
IPR001680	145	185	SM00320	WD-40 repeat
IPR001680	227	266	SM00320	WD-40 repeat
IPR001680	277	317	SM00320	WD-40 repeat
IPR001680	336	374	SM00320	WD-40 repeat
IPR001680	401	432	SM00320	WD-40 repeat
IPR001680	468	505	SM00320	WD-40 repeat
ProfileScan	IPR000694	2	50	PS50099	Proline-rich region
ScanRegExp	IPR000009	145	159	PS01024	Protein phosphatase 2A regulatory subunit PR55
IPR000009	236	250	PS01025	Protein phosphatase 2A regulatory subunit PR55

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	655 bp
Genome contig ID	gi65540054r_61446539
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGGCTGTAATCACTCCTTGCCATGTCTGGCACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATAAGGAAAAAAAAAAAAACTACTACTGAATAAAAGTGACAAAGAAT

Gene/Protein Characteristic Table for mKIAA4213

Features of the cloned DNA sequence

Features of the protein sequence