|
Order Kazusa clone(s) from : |
| Product ID | ORK06463 |
|---|---|
| Accession No | AB040974 |
| Description | protein phosphatase 2, regulatory subunit B, delta |
| Clone name | hg04104 |
| Vector information | |
| cDNA sequence | DNA sequence (6206 bp) Predicted protein sequence (477 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA1541
by Kazusa Mouse cDNA Project
|
Length: 6206 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 477 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000009 | 65 | 85 | PR00600 | Protein phosphatase 2A |
| IPR000009 | 100 | 128 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 129 | 157 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 206 | 233 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 234 | 261 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 262 | 290 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 291 | 318 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 319 | 346 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 347 | 372 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 373 | 399 | PR00600 | Protein phosphatase 2A | |
| IPR000009 | 443 | 472 | PR00600 | Protein phosphatase 2A | |
| HMMSmart | IPR001680 | 51 | 86 | SM00320 | WD40 repeat |
| IPR001680 | 113 | 153 | SM00320 | WD40 repeat | |
| IPR001680 | 195 | 234 | SM00320 | WD40 repeat | |
| IPR001680 | 245 | 285 | SM00320 | WD40 repeat | |
| IPR001680 | 304 | 342 | SM00320 | WD40 repeat | |
| IPR001680 | 369 | 400 | SM00320 | WD40 repeat | |
| IPR001680 | 436 | 473 | SM00320 | WD40 repeat | |
| ScanRegExp | IPR000009 | 113 | 127 | PS01024 | Protein phosphatase 2A |
| IPR000009 | 204 | 218 | PS01025 | Protein phosphatase 2A |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | ACGAGATCAGTGTGGACAGTC |
|---|---|
| Primer_r | AAATGTCCGGCTTAACTATGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 10
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |