Gene/Protein Characteristic Table for mKIAA1489

Length: 3778 bp

Restriction map

Length of 3'UTR	1353 bp
Genome contig ID	gi65504368r_56821851
PolyA signal sequence (AATAAA,-21)	+----*----+----*----+----*----+---- ACATTAATTTATTAAATAAATTGTATATAATCAGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATCTGTTGGTTTTTTGGTTTTTGTTTTTTTCTTTTGTGATGGGAGTACTC

KIAA	Alignment based on:
KIAA1489	DNA sequence, AA sequence, Physical map

Coding region: 542..2425

Length: 627 aa

Entry Exp ID% Protein Source EDL04715 0 100.0 mCG13111, isofo... Mus musculus EDL88051 0 99.7 kelch repeat an... Rattus norvegicus XP_539508 0 99.0 similar to Kelc... Canis lupus fam... XP_001500923 0 98.7 similar to Kelc... Equus caballus Q8IY47 0 98.6 Kelch repeat an... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220547 9.1e-34 27.7 mKIAA4210 BC058098 8.2e-31 26.3 mKIAA4181 AK220570 1e-28 25.9 mKIAA4249 AK129338 2.8e-28 26.5 mKIAA1354 AK122491 1.2e-26 25.2 mKIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000210	25	132	PF00651	BTB/POZ
	IPR011705	137	238	PF07707	BTB/Kelch-associated
	IPR006652	309	371	PF01344	Kelch repeat
	IPR011498	373	420	PF07646	Kelch
	IPR006652	373	420	PF01344	Kelch repeat
	IPR011498	462	520	PF07646	Kelch
	IPR006652	462	520	PF01344	Kelch repeat
HMMSmart	IPR000210	35	132	SM00225	BTB/POZ
ProfileScan	IPR000210	35	102	PS50097	BTB/POZ

Method	From	To	amino acid sequence
SOSUI	424	445	QWSAAVVVHDCIYVMTLNLMYC