ROUGE |
Gene/Protein Characteristic Table for mKIAA1489 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129374 |
---|---|
kelch repeat and BTB (POZ) domain containing 2. BTB and kelch domain containing 1. |
|
mph01025 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3778 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1353 bp Genome contig ID gi65504368r_56821851 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ACATTAATTTATTAAATAAATTGTATATAATCAGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCTGTTGGTTTTTTGGTTTTTGTTTTTTTCTTTTGTGATGGGAGTACTC
KIAA Alignment based on: KIAA1489 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 542..2425
Length: 627 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |