Gene/Protein Characteristic Table for mKIAA1354

Length: 4127 bp

Restriction map

Length of 3'UTR	1865 bp
Genome contig ID	gi65493515r_87604486
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- AGGATCTCTTTATATAATAAAATTACTTAACTGAT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATTTTCTTGTATTGCTTTTTTTTCTTCCTCTCAGGCTCTTAGTTTTACAA

KIAA	Alignment based on:
KIAA1354	DNA sequence, AA sequence, Physical map

Coding region: 223..2262

Length: 679 aa

Entry Exp ID% Protein Source Q6ZPT1 0 100.0 Kelch-like prot... Mus musculus XP_538682 0 94.8 similar to kelc... Canis lupus fam... EDL97739 0 99.5 kelch-like 9 (D... Rattus norvegicus Q9P2J3 0 98.7 Kelch-like prot... Homo sapiens Q2T9Z7 0 98.7 Kelch-like prot... Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122491 2.7e-218 89.2 mKIAA1309 AK131135 1e-79 36.8 mFLJ00127 AK173163 6.1e-65 37.4 mKIAA1384 AK220195 5.6e-59 32.6 mKIAA4221 AK220547 3.9e-54 30.6 mKIAA4210

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	606	619	PR00501	Kelch motif
	IPR006651	625	639	PR00501	Kelch motif
HMMPfam	IPR000210	102	211	PF00651	BTB/POZ
	IPR011705	216	317	PF07707	BTB/Kelch-associated
	IPR006652	349	396	PF01344	Kelch repeat
	IPR011498	398	448	PF07646	Kelch
	IPR006652	398	448	PF01344	Kelch repeat
	IPR006652	450	495	PF01344	Kelch repeat
	IPR011498	497	542	PF07646	Kelch
	IPR006652	497	542	PF01344	Kelch repeat
	IPR011498	544	594	PF07646	Kelch
	IPR006652	544	594	PF01344	Kelch repeat
	IPR011498	596	643	PF07646	Kelch
	IPR006652	596	643	PF01344	Kelch repeat
HMMSmart	IPR000210	112	211	SM00225	BTB/POZ
ProfileScan	IPR000210	112	181	PS50097	BTB/POZ

Method	From	To	amino acid sequence
-	-	-	-