Order Kazusa clone(s) from : ![]() |
Product ID | ORK05565 |
---|---|
Accession No | AB040922 |
Description | kelch repeat and BTB (POZ) domain containing 2 |
Clone name | fj07905 |
Vector information | |
cDNA sequence | DNA sequence (4330 bp) Predicted protein sequence (511 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1489
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1175 bp |
---|---|
Genome contig ID | gi89161213r_32774308 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 32874308 | 32878635 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011705 | 21 | 122 | PF07707 | BTB/Kelch-associated |
IPR006652 | 198 | 255 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 257 | 304 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 346 | 404 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR006652 | 205 | 268 | SM00612 | Kelch repeat type 1 |
IPR006652 | 269 | 317 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 318 | 357 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 358 | 420 | SM00612 | Kelch repeat type 1 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 308 | QWSAAVVVHDCIYVMTLNLMYC | 329 | PRIMARY | 22 |
---|
![]() |
Primer_f | TTAACCTGTTGTGTGCGTGTG |
---|---|
Primer_r | ACCTGTGCTCATGTTAGATTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |