Gene/Protein Characteristic Table for mKIAA1488

Length: 1295 bp

Restriction map

Length of 3'UTR	0 bp
Genome contig ID	gi65492966r_62056004
PolyA signal sequence (AATAGA,-7)	+----*----+----*----+----*----+---- CAAGAGGGGTTTCATGCAGGGTCATGTAAATAGAC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAGAAAAAGAAGAAAAAGAGGCCATCTATAAGGAACGCTGGCCAGCGTAT

KIAA	Alignment based on:
KIAA1488	DNA sequence, AA sequence, Physical map

Coding region: 20..1294

Length: 425 aa

Entry Exp ID% Protein Source AAI38062 9.1e-132 100.0 Dhx36 protein [... Mus musculus AAH06615 2.9e-131 99.5 Dhx36 protein [... Mus musculus EDL35384 5.1e-131 99.5 DEAH (Asp-Glu-A... Mus musculus Q8VHK9 5.1e-131 99.5 Probable ATP-de... Mus musculus EDM14820 1.6e-128 97.2 DEAH (Asp-Glu-A... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC065169 1.2e-24 39.8 mKIAA4209 AK122395 7.6e-23 35.6 mKIAA0890 AK172917 4.5e-16 37.8 mKIAA0224 AK122314 1.7e-15 32.3 mKIAA0577 AK220485 5.1e-15 41.7 mKIAA4096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	204	370	PF00270	DEAD/DEAH box helicase
HMMSmart	IPR011545	201	392	SM00487	DEAD/DEAH box helicase
ProfileScan	NULL	17	47	PS50315	NULL
	IPR001410	255	371	PS50136	DEAD/DEAH box helicase
ScanRegExp	IPR002464	325	334	PS00690	ATP-dependent helicase

Method	From	To	amino acid sequence
-	-	-	-