KIAA1488

Product ID	ORK04770
Accession No	AB040921
Description	DEAH (Asp-Glu-Ala-His) box polypeptide 36
Clone name	fj07893
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3060 bp) Predicted protein sequence (852 aa)
Source	Human fetal brain
Rouge ID	mKIAA1488 by Kazusa Mouse cDNA Project

Length: 3060 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	500 bp
Genome contig ID	gi89161205r_155376152
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCCAGTATTTAATAAAATGTACAATGTTAAATCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCAACCTCTTGGATTGGTTTCTACATTTTCACCTATGGCTTGGTTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	155476152	155515664	23	99.8	Perfect prediction

Length: 852 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW78761	100.0	DEAH (Asp-Glu-A...	Homo sapiens
Q9H2U1	99.9	Probable ATP-de...	Homo sapiens
XP_001147599	99.8	DEAH (Asp-Glu-A...	Pan troglodytes
XP_001106315	99.1	similar to DEAH...	Macaca mulatta
XP_534311	95.7	similar to DEAH...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020697	8.8e-55	36.3	KIAA0890
AB011149	5.2e-34	32.4	KIAA0577
D86977	3.4e-32	29.9	KIAA0224
D50924	1.3e-30	31.7	KIAA0134
AB040950	1.8e-22	28.1	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	54	218	PF00270	DNA/RNA helicase
	IPR001650	357	451	PF00271	DNA/RNA helicase
	IPR007502	513	604	PF04408	Helicase-associated region
	IPR011709	643	761	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	49	240	SM00487	DEAD-like helicases
HMMSmart	IPR001650	346	451	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	61	231	PS51192	Helicase
ProfileScan	IPR001650	321	491	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	173	182	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	547	GKMILFGALFCCLDPVLTIAASL	569	PRIMARY	23

Primer_f	CACCTAAAGATGAGAACAAGC
Primer_r	GCTGGAGACTGAAATACAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-