ROUGE

Gene/Protein Characteristic Table for mKIAA0890

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122395
Description :	HELG.
Clone Name :	mbg06494 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4813 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2374 bp

Genome contig ID gi65519420r_110010280
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTTTATTTAAAATAAAGTTATATTTATCCCTTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGCTGCTGTCCTCCCAAGGGCTCCTCTCAGGACTCTGGGCAGTGGCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0890 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0890	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 139..2235, 2628..2852, 3459..3815, 3913..4404
Length: 1057 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99PU8	86.2	Putative ATP-de...	Mus musculus
BAE32286	86.9	unnamed protein...	Mus musculus
Q5BJS0	86.3	Putative ATP-de...	Rattus norvegicus
BAE27081	86.2	unnamed protein...	Mus musculus
XP_001499652	85.5	DEAH (Asp-Glu-A...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129373	1.2e-29	35.6	mKIAA1488
BC065169	4.9e-27	29.4	mKIAA4209
AK129062	1.8e-20	32.7	mKIAA0134
AK122314	4.8e-20	39.4	mKIAA0577
AK172917	1.6e-16	33.1	mKIAA0224

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001159 78 146 PF00035 Double-stranded RNA binding

IPR011545 469 624 PF00270 DEAD/DEAH box helicase

IPR001650 695 772 PF00271 Helicase

IPR007502 763 856 PF04408 Helicase-associated region

IPR011709 900 1054 PF07717 Protein of unknown function DUF1605

HMMSmart IPR011545 457 646 SM00487 DEAD/DEAH box helicase

ProfileScan IPR001410 511 760 PS50136 DEAD/DEAH box helicase

ScanRegExp IPR002464 579 588 PS00690 ATP-dependent helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001159	78	146	PF00035	Double-stranded RNA binding
IPR011545	469	624	PF00270	DEAD/DEAH box helicase
IPR001650	695	772	PF00271	Helicase
IPR007502	763	856	PF04408	Helicase-associated region
IPR011709	900	1054	PF07717	Protein of unknown function DUF1605
HMMSmart	IPR011545	457	646	SM00487	DEAD/DEAH box helicase
ProfileScan	IPR001410	511	760	PS50136	DEAD/DEAH box helicase
ScanRegExp	IPR002464	579	588	PS00690	ATP-dependent helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 801 823 KAIVLAAIFRCLHPLLVVVSCLT

Method	From	To	amino acid sequence
SOSUI	801	823	KAIVLAAIFRCLHPLLVVVSCLT

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2374 bp
Genome contig ID	gi65519420r_110010280
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTTTATTTAAAATAAAGTTATATTTATCCCTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGCTGCTGTCCTCCCAAGGGCTCCTCTCAGGACTCTGGGCAGTGGCCC

Gene/Protein Characteristic Table for mKIAA0890

Features of the cloned DNA sequence

Features of the protein sequence