ROUGE

Gene/Protein Characteristic Table for mKIAA0224

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172917
Description :	DEAH (Asp-Glu-Ala-His) box polypeptide 38. pre-mRNA splicing factor 16. DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38.
Clone Name :	mpg04132 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1433 bp

Genome contig ID gi65515060r_108745689
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATGGGGTTTGGAAATAAATATATTATTTGTACAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTATTGCATTTTAAATCTCCTTTCTCTTTTATAGCTCTTATCCCTGCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0224 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0224	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 128..2755, 2764..3810
Length: 1224 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH46557	98.9	DEAH (Asp-Glu-A...	Mus musculus
XP_001097681	96.0	similar to DEAH...	Macaca mulatta
XP_001500257	96.3	similar to DEAH...	Equus caballus
XP_511101	95.9	DEAH (Asp-Glu-A...	Pan troglodytes
XP_536800	96.0	similar to DEAH...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220485	1e-84	41.6	mKIAA4096
AK129062	2.5e-26	35.6	mKIAA0134
AK122314	1e-25	37.8	mKIAA0577
AK220399	7.2e-15	30.8	mKIAA1517
AK129373	4.1e-14	38.2	mKIAA1488

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 538 699 PF00270 DEAD/DEAH box helicase

IPR001650 771 865 PF00271 Helicase

IPR007502 919 1009 PF04408 Helicase-associated region

IPR011709 1043 1145 PF07717 Protein of unknown function DUF1605

HMMSmart IPR011545 534 718 SM00487 DEAD/DEAH box helicase

IPR001650 762 865 SM00490 Helicase

ProfileScan NULL 105 301 PS50323 NULL

IPR001410 584 872 PS50136 DEAD/DEAH box helicase

ScanRegExp IPR002464 651 660 PS00690 ATP-dependent helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	538	699	PF00270	DEAD/DEAH box helicase
IPR001650	771	865	PF00271	Helicase
IPR007502	919	1009	PF04408	Helicase-associated region
IPR011709	1043	1145	PF07717	Protein of unknown function DUF1605
HMMSmart	IPR011545	534	718	SM00487	DEAD/DEAH box helicase
IPR001650	762	865	SM00490	Helicase
ProfileScan	NULL	105	301	PS50323	NULL
IPR001410	584	872	PS50136	DEAD/DEAH box helicase
ScanRegExp	IPR002464	651	660	PS00690	ATP-dependent helicase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1433 bp
Genome contig ID	gi65515060r_108745689
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGGGGTTTGGAAATAAATATATTATTTGTACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTATTGCATTTTAAATCTCCTTTCTCTTTTATAGCTCTTATCCCTGCAA

Gene/Protein Characteristic Table for mKIAA0224

Features of the cloned DNA sequence

Features of the protein sequence