ROUGE

Gene/Protein Characteristic Table for mKIAA4096

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220485
Description :
Clone Name :	mfj04296 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4294 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 497 bp

Genome contig ID gi65527427f_101454085
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTTCTACCTCCTGGAAATATTTATTTTTTTAAGG
Flanking genome sequence
(134360 - 134409)
----+----*----+----*----+----*----+----*----+----*
AAACAATGGTTTATTATGACTTTGTCTTGTTGGGCAGGGCTAGCTGTAAG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..3794
Length: 1264 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2A4P0	99.5	ATP-dependent R...	Mus musculus
BAE24985	99.4	unnamed protein...	Mus musculus
EDM06155	98.9	DEAH (Asp-Glu-A...	Rattus norvegicus
CAM22646	95.2	DEAH (Asp-Glu-A...	Mus musculus
AAQ96248	94.7	LRRGT00035 [Rat...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172917	1.2e-101	41.7	mKIAA0224
AK122314	6.2e-68	43.7	mKIAA0577
AK129062	5e-47	37.2	mKIAA0134
BC065169	1.8e-21	28.3	mKIAA4209
AK220399	2.1e-16	33.4	mKIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003029 305 380 PF00575 RNA binding S1

IPR011545 611 769 PF00270 DEAD/DEAH box helicase

IPR001650 845 939 PF00271 Helicase

IPR007502 1000 1090 PF04408 Helicase-associated region

IPR011709 1124 1224 PF07717 Protein of unknown function DUF1605

HMMSmart IPR003029 307 380 SM00316 RNA binding S1

IPR011545 607 791 SM00487 DEAD/DEAH box helicase

IPR001650 835 939 SM00490 Helicase

ProfileScan NULL 177 294 PS50323 NULL

NULL 195 241 PS50312 NULL

IPR003029 309 380 PS50126 RNA binding S1

IPR001410 657 946 PS50136 DEAD/DEAH box helicase

ScanRegExp IPR003439 357 371 PS00211 ABC transporter related

IPR002464 724 733 PS00690 ATP-dependent helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003029	305	380	PF00575	RNA binding S1
IPR011545	611	769	PF00270	DEAD/DEAH box helicase
IPR001650	845	939	PF00271	Helicase
IPR007502	1000	1090	PF04408	Helicase-associated region
IPR011709	1124	1224	PF07717	Protein of unknown function DUF1605
HMMSmart	IPR003029	307	380	SM00316	RNA binding S1
IPR011545	607	791	SM00487	DEAD/DEAH box helicase
IPR001650	835	939	SM00490	Helicase
ProfileScan	NULL	177	294	PS50323	NULL
NULL	195	241	PS50312	NULL
IPR003029	309	380	PS50126	RNA binding S1
IPR001410	657	946	PS50136	DEAD/DEAH box helicase
ScanRegExp	IPR003439	357	371	PS00211	ABC transporter related
IPR002464	724	733	PS00690	ATP-dependent helicase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	497 bp
Genome contig ID	gi65527427f_101454085
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTTCTACCTCCTGGAAATATTTATTTTTTTAAGG
Flanking genome sequence (134360 - 134409)	----+--------+--------+--------+--------+----* AAACAATGGTTTATTATGACTTTGTCTTGTTGGGCAGGGCTAGCTGTAAG

Gene/Protein Characteristic Table for mKIAA4096

Features of the cloned DNA sequence

Features of the protein sequence