ROUGE |
Gene/Protein Characteristic Table for mKIAA1449 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122511 |
---|---|
Golgi reassembly stacking protein 1. | |
mbg03116 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4969 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3812 bp Genome contig ID gi65519420f_119804865 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CTCGGGTTGTATAGAATAAAGCTTTAGTTACAAACFlanking genome sequence
(131676 - 131725) ----+----*----+----*----+----*----+----*----+----*
ACTTCAGTGTGCTGGACATGTTTATTTTTTCACTTGTCACTTTCCCCATA
KIAA Alignment based on: KIAA1449 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1076, 2235..3188
Length: 675 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |