ROUGE

Gene/Protein Characteristic Table for mKIAA4188

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220533
Description :	Transducin-like enhancer protein 2.
Clone Name :	mbh00640 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3626 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 134 bp

Genome contig ID gi65524842f_81611022
PolyA signal sequence
(AATATA,-17)
+----*----+----*----+----*----+----
GGGCTGGGGCACTGGGGAAATATAACACATTTATC
Flanking genome sequence
(116132 - 116181)
----+----*----+----*----+----*----+----*----+----*
AACTTGCTTTCTTTCTGTGTGTGTGTGAAGCGTACAGGTGAGGGACCCGA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2284..3489
Length: 402 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE25947	2.7e-168	100.0	unnamed protein...	Mus musculus
EDL31394	1.6e-167	99.8	transducin-like...	Mus musculus
Q9WVB2	1.7e-167	99.8	Transducin-like...	Mus musculus
EDL89138	1.9e-165	98.2	rCG29214, isofo...	Rattus norvegicus
EDL89137	1.9e-165	98.2	rCG29214, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122524	9.1e-107	77.2	mKIAA1547
AK122481	8.5e-102	76.4	mKIAA1261
BC064045	6e-06	20.6	mKIAA4167
AK122511	4.3e-05	25.4	mKIAA1449
AK037620	0.0005	23.6	mKIAA4156

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 244 277 PD000018 WD-40 repeat

FPrintScan IPR001680 221 235 PR00320 WD-40 repeat

IPR001680 263 277 PR00320 WD-40 repeat

IPR001680 345 359 PR00320 WD-40 repeat

HMMPfam IPR001680 108 143 PF00400 WD-40 repeat

IPR001680 153 190 PF00400 WD-40 repeat

IPR001680 197 234 PF00400 WD-40 repeat

IPR001680 239 276 PF00400 WD-40 repeat

IPR001680 321 358 PF00400 WD-40 repeat

IPR001680 363 399 PF00400 WD-40 repeat

HMMSmart IPR001680 106 143 SM00320 WD-40 repeat

IPR001680 149 190 SM00320 WD-40 repeat

IPR001680 195 234 SM00320 WD-40 repeat

IPR001680 237 276 SM00320 WD-40 repeat

IPR001680 319 358 SM00320 WD-40 repeat

IPR001680 359 399 SM00320 WD-40 repeat

ProfileScan IPR001680 112 285 PS50294 WD-40 repeat

IPR001680 202 243 PS50082 WD-40 repeat

IPR001680 244 285 PS50082 WD-40 repeat

IPR001680 326 357 PS50082 WD-40 repeat

IPR001680 326 402 PS50294 WD-40 repeat

ScanRegExp IPR001680 221 235 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	244	277	PD000018	WD-40 repeat
FPrintScan	IPR001680	221	235	PR00320	WD-40 repeat
IPR001680	263	277	PR00320	WD-40 repeat
IPR001680	345	359	PR00320	WD-40 repeat
HMMPfam	IPR001680	108	143	PF00400	WD-40 repeat
IPR001680	153	190	PF00400	WD-40 repeat
IPR001680	197	234	PF00400	WD-40 repeat
IPR001680	239	276	PF00400	WD-40 repeat
IPR001680	321	358	PF00400	WD-40 repeat
IPR001680	363	399	PF00400	WD-40 repeat
HMMSmart	IPR001680	106	143	SM00320	WD-40 repeat
IPR001680	149	190	SM00320	WD-40 repeat
IPR001680	195	234	SM00320	WD-40 repeat
IPR001680	237	276	SM00320	WD-40 repeat
IPR001680	319	358	SM00320	WD-40 repeat
IPR001680	359	399	SM00320	WD-40 repeat
ProfileScan	IPR001680	112	285	PS50294	WD-40 repeat
IPR001680	202	243	PS50082	WD-40 repeat
IPR001680	244	285	PS50082	WD-40 repeat
IPR001680	326	357	PS50082	WD-40 repeat
IPR001680	326	402	PS50294	WD-40 repeat
ScanRegExp	IPR001680	221	235	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	134 bp
Genome contig ID	gi65524842f_81611022
PolyA signal sequence (AATATA,-17)	+--------+--------+----*----+---- GGGCTGGGGCACTGGGGAAATATAACACATTTATC
Flanking genome sequence (116132 - 116181)	----+--------+--------+--------+--------+----* AACTTGCTTTCTTTCTGTGTGTGTGTGAAGCGTACAGGTGAGGGACCCGA

Gene/Protein Characteristic Table for mKIAA4188

Features of the cloned DNA sequence

Features of the protein sequence