ROUGE

Gene/Protein Characteristic Table for mKIAA0413

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220340
Description :	Apoptotic protease activating factor 1.
Clone Name :	meh00513 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 6546 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2132 bp

Genome contig ID gi65524842r_90860645
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTAAAACAAAAATAAAATTACTGAAATTTTTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAACATTTTGGTTTCGGGATCCTTTCTTGACTTTTTTCCCCTGCTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0413 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0413	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 659..4414
Length: 1251 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI31685	99.9	Apoptotic pepti...	Mus musculus
O88879	99.7	Apoptotic prote...	Mus musculus
Q9EPV5	96.0	Apoptotic prote...	Rattus norvegicus
AAL36935	95.8	apoptotic prote...	Rattus norvegicus
EDL21522	99.0	apoptotic pepti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC064045	8.7e-14	29.2	mKIAA4167
AK131120	1.9e-08	26.6	mFLJ00045
AB093260	5.9e-08	23.6	mKIAA0696
AK122511	3.7e-07	26.5	mKIAA1449
AK220183	4.6e-07	22.4	mKIAA4123

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 656 687 PD000018 WD-40 repeat

IPR001680 740 774 PD000018 WD-40 repeat

IPR001680 880 911 PD000018 WD-40 repeat

FPrintScan IPR000767 151 166 PR00364 Disease resistance protein

IPR000767 234 248 PR00364 Disease resistance protein

IPR000767 319 333 PR00364 Disease resistance protein

IPR001680 674 688 PR00320 WD-40 repeat

IPR001680 718 732 PR00320 WD-40 repeat

IPR001680 760 774 PR00320 WD-40 repeat

HMMPfam IPR001315 8 92 PF00619 Caspase Recruitment

IPR002182 111 416 PF00931 NB-ARC

IPR001680 608 645 PF00400 WD-40 repeat

IPR001680 650 687 PF00400 WD-40 repeat

IPR001680 692 731 PF00400 WD-40 repeat

IPR001680 736 773 PF00400 WD-40 repeat

IPR001680 791 827 PF00400 WD-40 repeat

IPR001680 833 870 PF00400 WD-40 repeat

IPR001680 875 912 PF00400 WD-40 repeat

IPR001680 954 991 PF00400 WD-40 repeat

IPR001680 996 1033 PF00400 WD-40 repeat

IPR001680 1037 1073 PF00400 WD-40 repeat

IPR001680 1078 1115 PF00400 WD-40 repeat

IPR001680 1120 1157 PF00400 WD-40 repeat

IPR001680 1171 1206 PF00400 WD-40 repeat

HMMSmart IPR001680 606 645 SM00320 WD-40 repeat

IPR001680 648 687 SM00320 WD-40 repeat

IPR001680 690 731 SM00320 WD-40 repeat

IPR001680 734 773 SM00320 WD-40 repeat

IPR001680 782 827 SM00320 WD-40 repeat

IPR001680 830 870 SM00320 WD-40 repeat

IPR001680 873 912 SM00320 WD-40 repeat

IPR001680 954 991 SM00320 WD-40 repeat

IPR001680 994 1033 SM00320 WD-40 repeat

IPR001680 1035 1073 SM00320 WD-40 repeat

IPR001680 1076 1115 SM00320 WD-40 repeat

IPR001680 1118 1157 SM00320 WD-40 repeat

IPR001680 1170 1206 SM00320 WD-40 repeat

ProfileScan IPR001315 3 92 PS50209 Caspase Recruitment

IPR001680 613 654 PS50082 WD-40 repeat

IPR001680 613 1215 PS50294 WD-40 repeat

IPR001680 655 696 PS50082 WD-40 repeat

IPR001680 697 740 PS50082 WD-40 repeat

IPR001680 741 782 PS50082 WD-40 repeat

IPR001680 880 912 PS50082 WD-40 repeat

IPR001680 1001 1042 PS50082 WD-40 repeat

IPR001680 1042 1082 PS50082 WD-40 repeat

IPR001680 1083 1117 PS50082 WD-40 repeat

IPR001680 1125 1166 PS50082 WD-40 repeat

ScanRegExp IPR001680 674 688 PS00678 WD-40 repeat

IPR001680 718 732 PS00678 WD-40 repeat

IPR001680 760 774 PS00678 WD-40 repeat

IPR001680 1144 1158 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	656	687	PD000018	WD-40 repeat
IPR001680	740	774	PD000018	WD-40 repeat
IPR001680	880	911	PD000018	WD-40 repeat
FPrintScan	IPR000767	151	166	PR00364	Disease resistance protein
IPR000767	234	248	PR00364	Disease resistance protein
IPR000767	319	333	PR00364	Disease resistance protein
IPR001680	674	688	PR00320	WD-40 repeat
IPR001680	718	732	PR00320	WD-40 repeat
IPR001680	760	774	PR00320	WD-40 repeat
HMMPfam	IPR001315	8	92	PF00619	Caspase Recruitment
IPR002182	111	416	PF00931	NB-ARC
IPR001680	608	645	PF00400	WD-40 repeat
IPR001680	650	687	PF00400	WD-40 repeat
IPR001680	692	731	PF00400	WD-40 repeat
IPR001680	736	773	PF00400	WD-40 repeat
IPR001680	791	827	PF00400	WD-40 repeat
IPR001680	833	870	PF00400	WD-40 repeat
IPR001680	875	912	PF00400	WD-40 repeat
IPR001680	954	991	PF00400	WD-40 repeat
IPR001680	996	1033	PF00400	WD-40 repeat
IPR001680	1037	1073	PF00400	WD-40 repeat
IPR001680	1078	1115	PF00400	WD-40 repeat
IPR001680	1120	1157	PF00400	WD-40 repeat
IPR001680	1171	1206	PF00400	WD-40 repeat
HMMSmart	IPR001680	606	645	SM00320	WD-40 repeat
IPR001680	648	687	SM00320	WD-40 repeat
IPR001680	690	731	SM00320	WD-40 repeat
IPR001680	734	773	SM00320	WD-40 repeat
IPR001680	782	827	SM00320	WD-40 repeat
IPR001680	830	870	SM00320	WD-40 repeat
IPR001680	873	912	SM00320	WD-40 repeat
IPR001680	954	991	SM00320	WD-40 repeat
IPR001680	994	1033	SM00320	WD-40 repeat
IPR001680	1035	1073	SM00320	WD-40 repeat
IPR001680	1076	1115	SM00320	WD-40 repeat
IPR001680	1118	1157	SM00320	WD-40 repeat
IPR001680	1170	1206	SM00320	WD-40 repeat
ProfileScan	IPR001315	3	92	PS50209	Caspase Recruitment
IPR001680	613	654	PS50082	WD-40 repeat
IPR001680	613	1215	PS50294	WD-40 repeat
IPR001680	655	696	PS50082	WD-40 repeat
IPR001680	697	740	PS50082	WD-40 repeat
IPR001680	741	782	PS50082	WD-40 repeat
IPR001680	880	912	PS50082	WD-40 repeat
IPR001680	1001	1042	PS50082	WD-40 repeat
IPR001680	1042	1082	PS50082	WD-40 repeat
IPR001680	1083	1117	PS50082	WD-40 repeat
IPR001680	1125	1166	PS50082	WD-40 repeat
ScanRegExp	IPR001680	674	688	PS00678	WD-40 repeat
IPR001680	718	732	PS00678	WD-40 repeat
IPR001680	760	774	PS00678	WD-40 repeat
IPR001680	1144	1158	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2132 bp
Genome contig ID	gi65524842r_90860645
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTAAAACAAAAATAAAATTACTGAAATTTTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACATTTTGGTTTCGGGATCCTTTCTTGACTTTTTTCCCCTGCTGTT

Gene/Protein Characteristic Table for mKIAA0413

Features of the cloned DNA sequence

Features of the protein sequence