ROUGE

Gene/Protein Characteristic Table for mKIAA1435

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220391
Description :
Clone Name :	mbp03169 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1260 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 24 bp

Genome contig ID gi65488608r_79943276
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCACACTGATCCCAGAGCTGGGTGATGTCTGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACACGTGATGCATAGCATCCTCCATGAATGGAGACCCTTCATGTAGCTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1435 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1435	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1236
Length: 411 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001104749	6.3e-183	99.8	WD repeat and F...	Mus musculus
Q8IWB7	7.3e-181	97.6	WD repeat and F...	Homo sapiens
Q2KIY3	1.3e-180	97.8	WD repeat and F...	Bos taurus
XP_001166904	3.9e-180	97.1	hypothetical pr...	Pan troglodytes
XP_001915602	2.4e-174	94.6	WD repeat and F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC064045	4.5e-05	21.7	mKIAA4167
AK122479	0.00012	27.1	mKIAA1255
AK129414	0.00016	32.4	mKIAA1643
AB093277	0.00054	25.6	mKIAA0993
AK046633	0.00066	36.6	mKIAA4212

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 195 229 PD000018 WD-40 repeat

FPrintScan IPR001680 40 54 PR00320 WD-40 repeat

IPR001680 215 229 PR00320 WD-40 repeat

IPR001680 382 396 PR00320 WD-40 repeat

HMMPfam IPR001680 16 53 PF00400 WD-40 repeat

IPR001680 106 142 PF00400 WD-40 repeat

IPR001680 191 228 PF00400 WD-40 repeat

IPR001680 234 271 PF00400 WD-40 repeat

IPR000306 280 354 PF01363 Zinc finger

IPR001680 358 395 PF00400 WD-40 repeat

HMMSmart IPR001680 14 53 SM00320 WD-40 repeat

IPR001680 57 97 SM00320 WD-40 repeat

IPR001680 104 143 SM00320 WD-40 repeat

IPR001680 146 184 SM00320 WD-40 repeat

IPR001680 189 228 SM00320 WD-40 repeat

IPR001680 232 271 SM00320 WD-40 repeat

IPR000306 277 354 SM00064 Zinc finger

IPR001680 356 395 SM00320 WD-40 repeat

ProfileScan IPR001680 21 52 PS50082 WD-40 repeat

IPR001680 21 280 PS50294 WD-40 repeat

IPR001680 196 229 PS50082 WD-40 repeat

IPR001680 239 280 PS50082 WD-40 repeat

IPR000306 282 353 PS50178 Zinc finger

ScanRegExp IPR001680 215 229 PS00678 WD-40 repeat

IPR001680 258 272 PS00678 WD-40 repeat

IPR001680 382 396 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	195	229	PD000018	WD-40 repeat
FPrintScan	IPR001680	40	54	PR00320	WD-40 repeat
IPR001680	215	229	PR00320	WD-40 repeat
IPR001680	382	396	PR00320	WD-40 repeat
HMMPfam	IPR001680	16	53	PF00400	WD-40 repeat
IPR001680	106	142	PF00400	WD-40 repeat
IPR001680	191	228	PF00400	WD-40 repeat
IPR001680	234	271	PF00400	WD-40 repeat
IPR000306	280	354	PF01363	Zinc finger
IPR001680	358	395	PF00400	WD-40 repeat
HMMSmart	IPR001680	14	53	SM00320	WD-40 repeat
IPR001680	57	97	SM00320	WD-40 repeat
IPR001680	104	143	SM00320	WD-40 repeat
IPR001680	146	184	SM00320	WD-40 repeat
IPR001680	189	228	SM00320	WD-40 repeat
IPR001680	232	271	SM00320	WD-40 repeat
IPR000306	277	354	SM00064	Zinc finger
IPR001680	356	395	SM00320	WD-40 repeat
ProfileScan	IPR001680	21	52	PS50082	WD-40 repeat
IPR001680	21	280	PS50294	WD-40 repeat
IPR001680	196	229	PS50082	WD-40 repeat
IPR001680	239	280	PS50082	WD-40 repeat
IPR000306	282	353	PS50178	Zinc finger
ScanRegExp	IPR001680	215	229	PS00678	WD-40 repeat
IPR001680	258	272	PS00678	WD-40 repeat
IPR001680	382	396	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	24 bp
Genome contig ID	gi65488608r_79943276
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCACACTGATCCCAGAGCTGGGTGATGTCTGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACGTGATGCATAGCATCCTCCATGAATGGAGACCCTTCATGTAGCTCA

Gene/Protein Characteristic Table for mKIAA1435

Features of the cloned DNA sequence

Features of the protein sequence